VHL Rabbit Polyclonal Antibody
VHL Polyclonal Antibody |
ABP60891-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50
- Applications tips:
|
Description: A polyclonal antibody for detection of VHL from Human. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50 |
VHL Polyclonal Antibody |
ABP60891-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50
- Applications tips:
|
Description: A polyclonal antibody for detection of VHL from Human. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50 |
VHL Polyclonal Antibody |
ABP56500-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68
- Applications tips:
|
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68 |
VHL Polyclonal Antibody |
ABP56500-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68
- Applications tips:
|
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68 |
VHL Polyclonal Antibody |
ABP56500-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68
- Applications tips:
|
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68 |
VHL Polyclonal Antibody |
46866-100ul |
SAB |
100ul |
EUR 252 |
VHL Polyclonal Antibody |
46866-50ul |
SAB |
50ul |
EUR 187 |
VHL Rabbit pAb |
A0377-100ul |
Abclonal |
100 ul |
EUR 308 |
VHL Rabbit pAb |
A0377-200ul |
Abclonal |
200 ul |
EUR 459 |
VHL Rabbit pAb |
A0377-20ul |
Abclonal |
20 ul |
EUR 183 |
VHL Rabbit pAb |
A0377-50ul |
Abclonal |
50 ul |
EUR 223 |
VHL Rabbit pAb |
A11240-100ul |
Abclonal |
100 ul |
EUR 308 |
VHL Rabbit pAb |
A11240-200ul |
Abclonal |
200 ul |
EUR 459 |
VHL Rabbit pAb |
A11240-20ul |
Abclonal |
20 ul |
EUR 183 |
VHL Rabbit pAb |
A11240-50ul |
Abclonal |
50 ul |
EUR 223 |
VHL Rabbit pAb |
A16287-100ul |
Abclonal |
100 ul |
EUR 308 |
VHL Rabbit pAb |
A16287-200ul |
Abclonal |
200 ul |
EUR 459 |
VHL Rabbit pAb |
A16287-20ul |
Abclonal |
20 ul |
EUR 183 |
VHL Rabbit pAb |
A16287-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
DLR-vHL-Hu-48T |
DL Develop |
48T |
EUR 549 |
- Should the Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Hippel Lindau Tumor Suppressor (vHL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
DLR-vHL-Hu-96T |
DL Develop |
96T |
EUR 718 |
- Should the Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Hippel Lindau Tumor Suppressor (vHL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
DLR-vHL-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Von Hippel Lindau Tumor Suppressor (vHL) in samples from tissue homogenates or other biological fluids. |
Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
DLR-vHL-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Von Hippel Lindau Tumor Suppressor (vHL) in samples from tissue homogenates or other biological fluids. |
Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RDR-vHL-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RDR-vHL-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RDR-vHL-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RDR-vHL-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RD-vHL-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RD-vHL-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RD-vHL-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RD-vHL-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Polyclonal VHL Antibody (C-term) |
APR10723G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VHL (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal Goat Anti-VHL Antibody |
AMM05157G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-VHL . This antibody is tested and proven to work in the following applications: |
VHL (phospho Ser68) Polyclonal Antibody |
ES7498-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VHL (phospho Ser68) from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA |
VHL (phospho Ser68) Polyclonal Antibody |
ES7498-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VHL (phospho Ser68) from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA |
VHL (phospho Ser68) Polyclonal Antibody |
ABP56499-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human VHL around the phosphorylation site of S68
- Applications tips:
|
Description: A polyclonal antibody for detection of VHL phospho Ser68) from Human, Mouse, Rat. This VHL phospho Ser68) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the phosphorylation site of S68 |
VHL (phospho Ser68) Polyclonal Antibody |
ABP56499-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human VHL around the phosphorylation site of S68
- Applications tips:
|
Description: A polyclonal antibody for detection of VHL phospho Ser68) from Human, Mouse, Rat. This VHL phospho Ser68) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the phosphorylation site of S68 |
VHL (phospho Ser68) Polyclonal Antibody |
ABP56499-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human VHL around the phosphorylation site of S68
- Applications tips:
|
Description: A polyclonal antibody for detection of VHL phospho Ser68) from Human, Mouse, Rat. This VHL phospho Ser68) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the phosphorylation site of S68 |
VHL Antibody |
AF6292 |
Affbiotech |
200ul |
EUR 304 |
Description: VHL Antibody detects endogenous levels of total VHL. |
VHL antibody |
70R-34605 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified Rabbit polyclonal VHL antibody |
VHL antibody |
70R-9757 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal VHL antibody |
VHL antibody |
10R-1029 |
Fitzgerald |
100 ul |
EUR 316 |
Description: Mouse monoclonal VHL antibody |
VHL Antibody |
32075-100ul |
SAB |
100ul |
EUR 252 |
VHL Antibody |
DF6104 |
Affbiotech |
200ul |
EUR 304 |
Description: VHL Antibody detects endogenous levels of total VHL. |
VHL Antibody |
1-CSB-PA991849 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200 |
VHL Antibody |
1-CSB-PA876839 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000 |
VHL Antibody |
1-CSB-PA071125 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
VHL Antibody |
1-CSB-PA060067 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000 |
VHL Antibody |
CSB-PA025852KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
VHL Antibody |
CSB-PA025852KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
VHL (Phospho-Ser68) Polyclonal Conjugated Antibody |
C12654 |
SAB |
100ul |
EUR 397 |
VHL Conjugated Antibody |
C32075 |
SAB |
100ul |
EUR 397 |
anti- VHL antibody |
FNab09402 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: IF: 1:10-1:100
- IHC: 1:20-1:200
- Immunogen: von Hippel-Lindau tumor suppressor
- Uniprot ID: P40337
- Gene ID: 7428
- Research Area: Cancer, Metabolism
|
Description: Antibody raised against VHL |
anti- VHL antibody |
FNab10175 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: IHC: 1:50-1:500
- Immunogen: Histone-lysine N-methyltransferase EZH2
- Uniprot ID: P40337
- Gene ID: 7428
|
Description: Antibody raised against VHL |
VHL (pS68) Antibody |
abx219320-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Human VHL Antibody |
32825-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-VHL antibody |
STJ98809 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to VHL. |
Anti-VHL antibody |
STJ96241 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to VHL. |
Anti-VHL antibody |
STJ26089 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed. |
Anti-VHL antibody |
STJ113440 |
St John's Laboratory |
50 µl |
EUR 277 |
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed. |
Anti-VHL antibody |
STJ113742 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed. |
VHL siRNA |
20-abx906024 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VHL siRNA |
20-abx939411 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VHL siRNA |
20-abx939412 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-VHL (Ser68) Antibody |
AF8334 |
Affbiotech |
200ul |
EUR 376 |
Description: VHL (Phospho-Ser68) Antibody detects endogenous levels of VHL only when phosphorylated at Ser68. |
VHL (Phospho-Ser68) Antibody |
12654-100ul |
SAB |
100ul |
EUR 252 |
VHL (Phospho-Ser68) Antibody |
12654-50ul |
SAB |
50ul |
EUR 187 |
Phospho-VHL (S68) Antibody |
1-CSB-PA060066 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-VHL (S68). Recognizes Phospho-VHL (S68) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000 |
Polyclonal VHL / Von Hippel Lindau Antibody (aa34-83) |
APR10721G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VHL / Von Hippel Lindau (aa34-83). This antibody is tested and proven to work in the following applications: |
VHL Blocking Peptide |
AF6292-BP |
Affbiotech |
1mg |
EUR 195 |
VHL cloning plasmid |
CSB-CL025852HU-10ug |
Cusabio |
10ug |
EUR 255 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 519
- Sequence: atgccccggagggcggagaactgggacgaggccgaggtaggcgcggaggaggcaggcgtcgaagagtacggccctgaagaagacggcggggaggagtcgggcgccgaggagtccggcccggaagagtccggcccggaggaactgggcgccgaggaggagatggaggccgggcggcc
- Show more
|
Description: A cloning plasmid for the VHL gene. |
VHL Mouse mAb |
A11872-100ul |
Abclonal |
100 ul |
Ask for price |
VHL Mouse mAb |
A11872-200ul |
Abclonal |
200 ul |
Ask for price |
VHL Mouse mAb |
A11872-20ul |
Abclonal |
20 ul |
Ask for price |
VHL Mouse mAb |
A11872-50ul |
Abclonal |
50 ul |
EUR 265 |
VHL Blocking Peptide |
33R-2312 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VHL antibody, catalog no. 70R-9757 |
VHL Blocking Peptide |
DF6104-BP |
Affbiotech |
1mg |
EUR 195 |
Recombinant human VHL |
P2120 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: P40337
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human VHL |
Human VHL Antibody (Biotin Conjugate) |
32825-05121 |
AssayPro |
150 ug |
EUR 369 |
Anti-Phospho-VHL (S68) antibody |
STJ91273 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Phospho-VHL (S68). |
Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat) |
4-PAJ769Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: vHL (Ala6~Gln175)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL) |
Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), APC |
4-PAJ769Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: vHL (Ala6~Gln175)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with APC. |
Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), Biotinylated |
4-PAJ769Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: vHL (Ala6~Gln175)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with Biotin. |
Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), Cy3 |
4-PAJ769Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: vHL (Ala6~Gln175)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with Cy3. |
Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), FITC |
4-PAJ769Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: vHL (Ala6~Gln175)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with FITC. |
Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), HRP |
4-PAJ769Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: vHL (Ala6~Gln175)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with HRP. |
Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), PE |
4-PAJ769Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: vHL (Ala6~Gln175)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with PE. |
Human VHL AssayLite Antibody (FITC Conjugate) |
32825-05141 |
AssayPro |
150 ug |
EUR 428 |
Human VHL AssayLite Antibody (RPE Conjugate) |
32825-05151 |
AssayPro |
150 ug |
EUR 428 |
Human VHL AssayLite Antibody (APC Conjugate) |
32825-05161 |
AssayPro |
150 ug |
EUR 428 |
Human VHL AssayLite Antibody (PerCP Conjugate) |
32825-05171 |
AssayPro |
150 ug |
EUR 471 |
Rat VHL shRNA Plasmid |
20-abx984685 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human VHL shRNA Plasmid |
20-abx955082 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse VHL shRNA Plasmid |
20-abx973364 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
VHL Recombinant Protein (Human) |
RP034324 |
ABM |
100 ug |
Ask for price |
VHL Recombinant Protein (Rat) |
RP236390 |
ABM |
100 ug |
Ask for price |
VHL Recombinant Protein (Mouse) |
RP183791 |
ABM |
100 ug |
Ask for price |
Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAJ769Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: vHL (Ala6~Gln175)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with APC-Cy7. |
Monoclonal VHL Antibody (monoclonal) (M01), Clone: 1G12 |
APR10724G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human VHL (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1G12. This antibody is applicable in WB and IF, E |
Von Hippel Lindau Tumor Suppressor (vHL) Antibody |
20-abx131162 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Von Hippel Lindau Tumor Suppressor (vHL) Antibody |
20-abx175113 |
Abbexa |
|
|
|
Von Hippel Lindau Tumor Suppressor (VHL) Antibody |
20-abx323201 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Von Hippel Lindau Tumor Suppressor (VHL) Antibody |
20-abx326550 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Von Hippel Lindau Tumor Suppressor (VHL) Antibody |
20-abx211119 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Von Hippel Lindau Tumor Suppressor (VHL) Antibody |
20-abx210322 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-VHL (Ser68) Blocking Peptide |
AF8334-BP |
Affbiotech |
1mg |
EUR 195 |
Vhl ORF Vector (Rat) (pORF) |
ORF078798 |
ABM |
1.0 ug DNA |
EUR 506 |
VHL ORF Vector (Human) (pORF) |
ORF011442 |
ABM |
1.0 ug DNA |
EUR 95 |
Vhl ORF Vector (Mouse) (pORF) |
ORF061265 |
ABM |
1.0 ug DNA |
EUR 506 |
VHL ELISA Kit (Rat) (OKCD02977) |
OKCD02977 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: Involved in the ubiquitination and subsequent proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Seems to act as a target recruitment subunit in the E3 ubiquitin ligase complex and recruits hydroxylated hypoxia-inducible factor (HIF) under normoxic conditions. Involved in transcriptional repression through interaction with HIF1A, HIF1AN and histone deacetylases. Ubiquitinates, in an oxygen-responsive manner, ADRB2. <p>This subsection of the <a href="//www.uniprot.org/help/function_section">‘Function’</a> section describes the metabolic pathway(s) associated with a protein.<p><a href='/help/pathway' target='_top'>More...</a></p>Pathwayi: protein ubiquitinationThis protein is involved in the pathway protein ubiquitination, which is part of Protein modification._x000D_View all proteins of this organism that are known to be involved in the pathway protein ubiquitination and in Protein modification. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.113 ng/mL |
VHL ELISA Kit (Mouse) (OKEH05306) |
OKEH05306 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Involved in the ubiquitination and subsequent proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Seems to act as a target recruitment subunit in the E3 ubiquitin ligase complex and recruits hydroxylated hypoxia-inducible factor (HIF) under normoxic conditions. Involved in transcriptional repression through interaction with HIF1A, HIF1AN and histone deacetylases. Ubiquitinates, in an oxygen-responsive manner, ADRB2. This subsection of the ‘Function’ section describes the metabolic pathway(s) associated with a protein. More..;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL |
VHL ELISA Kit (Rat) (OKEH07205) |
OKEH07205 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Involved in the ubiquitination and subsequent proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Seems to act as a target recruitment subunit in the E3 ubiquitin ligase complex and recruits hydroxylated hypoxia-inducible factor (HIF) under normoxic conditions. Involved in transcriptional repression through interaction with HIF1A, HIF1AN and histone deacetylases. Ubiquitinates, in an oxygen-responsive manner, ADRB2.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL |
Mouse Anti-Human VHL monoclonal antibody, clone JID794 |
CABT-L2880-100uL500uL |
Creative Diagnostics |
100 uL, 500 uL |
EUR 502 |
Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody |
abx125410-50ul |
Abbexa |
50 ul |
EUR 356 |
- Shipped within 5-10 working days.
|
Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody |
20-abx126781 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody |
abx117007-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody |
20-abx000699 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody |
20-abx137392 |
Abbexa |
-
EUR 704.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody |
abx032864-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody |
abx032864-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody |
abx032865-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody |
abx032865-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody |
abx012353-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody |
abx219331-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody |
abx431703-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody |
abx239402-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
VHL protein, betadomain protein (His tag) |
80R-1008 |
Fitzgerald |
100 ug |
EUR 224 |
Description: Purified recombinant Human VHL protein, betadomain protein |
VHL sgRNA CRISPR Lentivector set (Human) |
K2611301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Vhl sgRNA CRISPR Lentivector set (Mouse) |
K4414101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Vhl sgRNA CRISPR Lentivector set (Rat) |
K6798701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody (Biotin) |
abx431704-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
VHL sgRNA CRISPR Lentivector (Human) (Target 1) |
K2611302 |
ABM |
1.0 ug DNA |
EUR 154 |
VHL sgRNA CRISPR Lentivector (Human) (Target 2) |
K2611303 |
ABM |
1.0 ug DNA |
EUR 154 |
VHL sgRNA CRISPR Lentivector (Human) (Target 3) |
K2611304 |
ABM |
1.0 ug DNA |
EUR 154 |
Vhl sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4414102 |
ABM |
1.0 ug DNA |
EUR 154 |
Vhl sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4414103 |
ABM |
1.0 ug DNA |
EUR 154 |
Vhl sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4414104 |
ABM |
1.0 ug DNA |
EUR 154 |
Vhl sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6798702 |
ABM |
1.0 ug DNA |
EUR 154 |
Vhl sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6798703 |
ABM |
1.0 ug DNA |
EUR 154 |
Vhl sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6798704 |
ABM |
1.0 ug DNA |
EUR 154 |
VHL Protein Vector (Human) (pPB-C-His) |
PV045765 |
ABM |
500 ng |
EUR 329 |
VHL Protein Vector (Human) (pPB-N-His) |
PV045766 |
ABM |
500 ng |
EUR 329 |
VHL Protein Vector (Human) (pPM-C-HA) |
PV045767 |
ABM |
500 ng |
EUR 329 |
VHL Protein Vector (Human) (pPM-C-His) |
PV045768 |
ABM |
500 ng |
EUR 329 |
Recombinant Von Hippel Lindau Tumor Suppressor (vHL) |
4-RPJ769Ra01 |
Cloud-Clone |
-
EUR 512.16
-
EUR 240.00
-
EUR 1645.60
-
EUR 615.20
-
EUR 1130.40
-
EUR 406.00
-
EUR 3964.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q64259
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 23.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Von Hippel Lindau Tumor Suppressor expressed in: E.coli |
Recombinant Human VHL Protein, His, E.coli-10ug |
QP13934-10ug |
EnQuireBio |
10ug |
EUR 155 |
Recombinant Human VHL Protein, His, E.coli-1mg |
QP13934-1mg |
EnQuireBio |
1mg |
EUR 1859 |
Recombinant Human VHL Protein, His, E.coli-50ug |
QP13934-50ug |
EnQuireBio |
50ug |
EUR 201 |
VHL Protein Vector (Rat) (pPB-C-His) |
PV315190 |
ABM |
500 ng |
EUR 603 |
VHL Protein Vector (Rat) (pPB-N-His) |
PV315191 |
ABM |
500 ng |
EUR 603 |
VHL Protein Vector (Rat) (pPM-C-HA) |
PV315192 |
ABM |
500 ng |
EUR 603 |
VHL Protein Vector (Rat) (pPM-C-His) |
PV315193 |
ABM |
500 ng |
EUR 603 |
VHL Protein Vector (Mouse) (pPB-C-His) |
PV245058 |
ABM |
500 ng |
EUR 603 |
VHL Protein Vector (Mouse) (pPB-N-His) |
PV245059 |
ABM |
500 ng |
EUR 603 |
VHL Protein Vector (Mouse) (pPM-C-HA) |
PV245060 |
ABM |
500 ng |
EUR 603 |
VHL Protein Vector (Mouse) (pPM-C-His) |
PV245061 |
ABM |
500 ng |
EUR 603 |
Vhl 3'UTR GFP Stable Cell Line |
TU171762 |
ABM |
1.0 ml |
Ask for price |
VHL 3'UTR GFP Stable Cell Line |
TU078117 |
ABM |
1.0 ml |
EUR 1521 |
Vhl 3'UTR Luciferase Stable Cell Line |
TU121762 |
ABM |
1.0 ml |
Ask for price |
VHL 3'UTR Luciferase Stable Cell Line |
TU028117 |
ABM |
1.0 ml |
EUR 1521 |
Vhl 3'UTR Luciferase Stable Cell Line |
TU223038 |
ABM |
1.0 ml |
Ask for price |
Vhl 3'UTR GFP Stable Cell Line |
TU273038 |
ABM |
1.0 ml |
Ask for price |
VHL ELISA Kit (Human) : 96 Wells (OKEH01354) |
OKEH01354 |
Aviva Systems Biology |
96 Wells |
EUR 740 |
Description: Description of target: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VHL Rabbit Polyclonal Antibody