TPPP Rabbit Polyclonal Antibody

TPPP Rabbit Polyclonal Antibody

 

TPPP Rabbit mAb
A4637-100ul 100 ul
EUR 410

TPPP Rabbit mAb
A4637-200ul 200 ul
EUR 571

TPPP Rabbit mAb
A4637-20ul 20 ul
EUR 221

TPPP Rabbit mAb
A4637-50ul 50 ul
EUR 287

TPPP Rabbit pAb
A8574-100ul 100 ul
EUR 308

TPPP Rabbit pAb
A8574-200ul 200 ul
EUR 459

TPPP Rabbit pAb
A8574-20ul 20 ul
EUR 183

TPPP Rabbit pAb
A8574-50ul 50 ul
EUR 223

Polyclonal TPPP Antibody (Internal)
APR13793G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TPPP (Internal). This antibody is tested and proven to work in the following applications:

Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
DLR-TPPP-Hu-48T 48T
EUR 479
  • Should the Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
DLR-TPPP-Hu-96T 96T
EUR 621
  • Should the Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
DLR-TPPP-Mu-48T 48T
EUR 489
  • Should the Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates or other biological fluids.

Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
DLR-TPPP-Mu-96T 96T
EUR 635
  • Should the Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates or other biological fluids.

Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RDR-TPPP-Hu-48Tests 48 Tests
EUR 500

Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RDR-TPPP-Hu-96Tests 96 Tests
EUR 692

Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RDR-TPPP-Mu-48Tests 48 Tests
EUR 511

Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RDR-TPPP-Mu-96Tests 96 Tests
EUR 709

Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RD-TPPP-Hu-48Tests 48 Tests
EUR 478

Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RD-TPPP-Hu-96Tests 96 Tests
EUR 662

Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RD-TPPP-Mu-48Tests 48 Tests
EUR 489

Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RD-TPPP-Mu-96Tests 96 Tests
EUR 677

Rabbit TPPP ELISA Kit
ERTT0320 96Tests
EUR 521

TPPP antibody
70R-20942 50 ul
EUR 435
Description: Rabbit polyclonal TPPP antibody

TPPP Antibody
ABD7880 100 ug
EUR 438

TPPP Antibody
ABD7919 100 ug
EUR 438

TPPP Antibody
42950-100ul 100ul
EUR 252

TPPP antibody
70R-10328 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TPPP antibody

TPPP Antibody
DF7880 200ul
EUR 304
Description: TPPP Antibody detects endogenous levels of total TPPP.

TPPP Antibody
1-CSB-PA024115ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TPPP. Recognizes TPPP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

TPPP Antibody
1-CSB-PA024115GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TPPP. Recognizes TPPP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal Tppp antibody - C-terminal region
AMM08300G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Tppp - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal TPPP/p25 Antibody (internal region)
APR13794G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TPPP/p25 (internal region). This antibody is tested and proven to work in the following applications:

TPPP (Phospho-Ser18) Polyclonal Conjugated Antibody
C12649 100ul
EUR 397

TPPP Conjugated Antibody
C42950 100ul
EUR 397

anti- TPPP antibody
FNab08897 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: tubulin polymerization promoting protein
  • Uniprot ID: O94811
  • Gene ID: 11076
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against TPPP

anti- TPPP antibody
FNab08898 100µg
EUR 585
  • Immunogen: tubulin polymerization promoting protein
  • Uniprot ID: O94811
  • Gene ID: 11076
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against TPPP

TPPP (pS18) Antibody
abx219079-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-TPPP antibody
PAab08897 100 ug
EUR 412

Anti-TPPP antibody
PAab08898 100 ug
EUR 412

Anti-TPPP antibody
STJ111309 100 µl
EUR 277

Anti-TPPP antibody
STJ190143 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TPPP

TPPP siRNA
20-abx937861
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPPP siRNA
20-abx937862
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospho-TPPP (Ser18) Antibody
AF8329 200ul
EUR 376
Description: TPPP (Phospho-Ser18) Antibody detects endogenous levels of TPPP only when phosphorylated at Ser18.

TPPP (Phospho- Ser18) Antibody
ABF8329 100 ug
EUR 438

TPPP (Phospho-Ser18) Antibody
12649-100ul 100ul
EUR 252

TPPP (Phospho-Ser18) Antibody
12649-50ul 50ul
EUR 187

Anti-TPPP/p25 antibody
STJ72121 100 µg
EUR 359

TPPP cloning plasmid
CSB-CL024115HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 660
  • Sequence: ATGGCTGACAAGGCCAAGCCTGCCAAAGCTGCCAACAGGACGCCCCCCAAGTCCCCGGGGGACCCCTCGAAGGACCGGGCAGCCAAGAGGCTGTCGCTGGAATCGGAGGGTGCTGGTGAGGGGGCAGCCGCATCCCCTGAGCTCAGTGCCCTGGAGGAGGCCTTCCGGCGCTTTGC
  • Show more
Description: A cloning plasmid for the TPPP gene.

TPPP Blocking Peptide
33R-4660 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TPPP antibody, catalog no. 70R-10328

TPPP Blocking Peptide
DF7880-BP 1mg
EUR 195

Monoclonal TPPP Antibody, Clone: EPR3315
APR13782G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TPPP. The antibodies are raised in Rabbit and are from clone EPR3315. This antibody is applicable in WB and IHC

Monoclonal TPPP Antibody, Clone: EPR3316
APR13783G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TPPP. The antibodies are raised in Rabbit and are from clone EPR3316. This antibody is applicable in WB, IHC and IF

Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse)
4-PAA993Hu01
  • EUR 232.00
  • EUR 2272.00
  • EUR 571.00
  • EUR 288.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP)

Rabbit Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
abx362823-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), APC
4-PAA993Hu01-APC
  • EUR 323.00
  • EUR 2951.00
  • EUR 831.00
  • EUR 407.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with APC.

Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAA993Hu01-Biotin
  • EUR 295.00
  • EUR 2222.00
  • EUR 668.00
  • EUR 357.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with Biotin.

Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), Cy3
4-PAA993Hu01-Cy3
  • EUR 389.00
  • EUR 3893.00
  • EUR 1067.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with Cy3.

Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), FITC
4-PAA993Hu01-FITC
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with FITC.

Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), HRP
4-PAA993Hu01-HRP
  • EUR 296.00
  • EUR 2574.00
  • EUR 737.00
  • EUR 369.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with HRP.

Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), PE
4-PAA993Hu01-PE
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with PE.

Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx123553
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx116340
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx104140
  • EUR 398.00
  • EUR 133.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tubulin Polymerization Promoting Protein (TPPP) Antibody
abx029266-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tubulin Polymerization Promoting Protein (TPPP) Antibody
abx029266-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx174961
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

 

TPPP Rabbit Polyclonal Antibody