TPPP Rabbit Polyclonal Antibody
TPPP Rabbit mAb |
A4637-100ul |
Abclonal |
100 ul |
EUR 410 |
TPPP Rabbit mAb |
A4637-200ul |
Abclonal |
200 ul |
EUR 571 |
TPPP Rabbit mAb |
A4637-20ul |
Abclonal |
20 ul |
EUR 221 |
TPPP Rabbit mAb |
A4637-50ul |
Abclonal |
50 ul |
EUR 287 |
TPPP Rabbit pAb |
A8574-100ul |
Abclonal |
100 ul |
EUR 308 |
TPPP Rabbit pAb |
A8574-200ul |
Abclonal |
200 ul |
EUR 459 |
TPPP Rabbit pAb |
A8574-20ul |
Abclonal |
20 ul |
EUR 183 |
TPPP Rabbit pAb |
A8574-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal TPPP Antibody (Internal) |
APR13793G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TPPP (Internal). This antibody is tested and proven to work in the following applications: |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
DLR-TPPP-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
DLR-TPPP-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
DLR-TPPP-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates or other biological fluids. |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
DLR-TPPP-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates or other biological fluids. |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RDR-TPPP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RDR-TPPP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RDR-TPPP-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RDR-TPPP-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RD-TPPP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RD-TPPP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RD-TPPP-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RD-TPPP-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Rabbit TPPP ELISA Kit |
ERTT0320 |
Abclonal |
96Tests |
EUR 521 |
TPPP antibody |
70R-20942 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TPPP antibody |
TPPP Antibody |
42950-100ul |
SAB |
100ul |
EUR 252 |
TPPP antibody |
70R-10328 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal TPPP antibody |
TPPP Antibody |
DF7880 |
Affbiotech |
200ul |
EUR 304 |
Description: TPPP Antibody detects endogenous levels of total TPPP. |
TPPP Antibody |
1-CSB-PA024115ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against TPPP. Recognizes TPPP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
TPPP Antibody |
1-CSB-PA024115GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against TPPP. Recognizes TPPP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Polyclonal Tppp antibody - C-terminal region |
AMM08300G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Tppp - C-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal TPPP/p25 Antibody (internal region) |
APR13794G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TPPP/p25 (internal region). This antibody is tested and proven to work in the following applications: |
TPPP (Phospho-Ser18) Polyclonal Conjugated Antibody |
C12649 |
SAB |
100ul |
EUR 397 |
TPPP Conjugated Antibody |
C42950 |
SAB |
100ul |
EUR 397 |
anti- TPPP antibody |
FNab08897 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: tubulin polymerization promoting protein
- Uniprot ID: O94811
- Gene ID: 11076
- Research Area: Signal Transduction, Developmental biology
|
Description: Antibody raised against TPPP |
anti- TPPP antibody |
FNab08898 |
FN Test |
100µg |
EUR 585 |
- Immunogen: tubulin polymerization promoting protein
- Uniprot ID: O94811
- Gene ID: 11076
- Research Area: Signal Transduction, Developmental biology
|
Description: Antibody raised against TPPP |
TPPP (pS18) Antibody |
abx219079-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Anti-TPPP antibody |
STJ190143 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TPPP |
TPPP siRNA |
20-abx937861 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TPPP siRNA |
20-abx937862 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-TPPP (Ser18) Antibody |
AF8329 |
Affbiotech |
200ul |
EUR 376 |
Description: TPPP (Phospho-Ser18) Antibody detects endogenous levels of TPPP only when phosphorylated at Ser18. |
TPPP (Phospho-Ser18) Antibody |
12649-100ul |
SAB |
100ul |
EUR 252 |
TPPP (Phospho-Ser18) Antibody |
12649-50ul |
SAB |
50ul |
EUR 187 |
TPPP cloning plasmid |
CSB-CL024115HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 660
- Sequence: ATGGCTGACAAGGCCAAGCCTGCCAAAGCTGCCAACAGGACGCCCCCCAAGTCCCCGGGGGACCCCTCGAAGGACCGGGCAGCCAAGAGGCTGTCGCTGGAATCGGAGGGTGCTGGTGAGGGGGCAGCCGCATCCCCTGAGCTCAGTGCCCTGGAGGAGGCCTTCCGGCGCTTTGC
- Show more
|
Description: A cloning plasmid for the TPPP gene. |
TPPP Blocking Peptide |
33R-4660 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TPPP antibody, catalog no. 70R-10328 |
TPPP Blocking Peptide |
DF7880-BP |
Affbiotech |
1mg |
EUR 195 |
Monoclonal TPPP Antibody, Clone: EPR3315 |
APR13782G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human TPPP. The antibodies are raised in Rabbit and are from clone EPR3315. This antibody is applicable in WB and IHC |
Monoclonal TPPP Antibody, Clone: EPR3316 |
APR13783G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human TPPP. The antibodies are raised in Rabbit and are from clone EPR3316. This antibody is applicable in WB, IHC and IF |
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse) |
4-PAA993Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2272.00
-
EUR 571.00
-
EUR 288.00
-
EUR 207.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP) |
Rabbit Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
abx362823-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), APC |
4-PAA993Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2951.00
-
EUR 831.00
-
EUR 407.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with APC. |
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAA993Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2222.00
-
EUR 668.00
-
EUR 357.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with Biotin. |
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAA993Hu01-Cy3 |
Cloud-Clone |
-
EUR 389.00
-
EUR 3893.00
-
EUR 1067.00
-
EUR 501.00
-
EUR 237.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with Cy3. |
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), FITC |
4-PAA993Hu01-FITC |
Cloud-Clone |
-
EUR 278.00
-
EUR 2380.00
-
EUR 685.00
-
EUR 346.00
-
EUR 187.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with FITC. |
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), HRP |
4-PAA993Hu01-HRP |
Cloud-Clone |
-
EUR 296.00
-
EUR 2574.00
-
EUR 737.00
-
EUR 369.00
-
EUR 198.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with HRP. |
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), PE |
4-PAA993Hu01-PE |
Cloud-Clone |
-
EUR 278.00
-
EUR 2380.00
-
EUR 685.00
-
EUR 346.00
-
EUR 187.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with PE. |
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
20-abx123553 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
20-abx116340 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
20-abx104140 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1094.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
abx029266-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
abx029266-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
20-abx174961 |
Abbexa |
|
|
|
TPPP Rabbit Polyclonal Antibody