Tmem72 Rabbit Polyclonal Antibody

Tmem72 Rabbit Polyclonal Antibody

 

Anti-Tmem72 antibody

STJ99663 200 µl
EUR 197
Description: Rabbit polyclonal to Tmem72.

TMEM72 siRNA

20-abx937436
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMEM72 siRNA

20-abx937437
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMEM72 cloning plasmid

CSB-CL023876HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 828
  • Sequence: ATGCAGCTCCAGGTGTTCTGGACTGGGCTGGAATACACCTGCCGGCTCCTGGGCATCACCACTGCTGCAGTGTTGATCGGCGTGGGCACTGAGACCTTCCTCCAGGGCCAGTTCAAAAGCCTGGCTTTCTATCTGCTGTTTACAGGAGCCGCTGTCTCCATATGTGAAGGGGCCTA
  • Show more
Description: A cloning plasmid for the TMEM72 gene.

Human TMEM72 shRNA Plasmid

20-abx968447
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TMEM72 shRNA Plasmid

20-abx983315
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TMEM72 Recombinant Protein (Rat)

RP233861 100 ug Ask for price

TMEM72 Recombinant Protein (Human)

RP044290 100 ug Ask for price

TMEM72 Recombinant Protein (Mouse)

RP179885 100 ug Ask for price

Tmem72 ORF Vector (Rat) (pORF)

ORF077955 1.0 ug DNA
EUR 506

TMEM72 ORF Vector (Human) (pORF)

ORF014764 1.0 ug DNA
EUR 354

Tmem72 ORF Vector (Mouse) (pORF)

ORF059963 1.0 ug DNA
EUR 506

Tmem72 sgRNA CRISPR Lentivector set (Rat)

K6630001 3 x 1.0 ug
EUR 339

Tmem72 sgRNA CRISPR Lentivector set (Mouse)

K3780401 3 x 1.0 ug
EUR 339

TMEM72 sgRNA CRISPR Lentivector set (Human)

K2393101 3 x 1.0 ug
EUR 339

TMEM72-AS1 ORF Vector (Human) (pORF)

ORF034069 1.0 ug DNA Ask for price

Human Transmembrane protein 72, TMEM72 ELISA KIT

ELI-17128h 96 Tests
EUR 824

Mouse Transmembrane protein 72, Tmem72 ELISA KIT

ELI-36435m 96 Tests
EUR 865

Tmem72 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6630002 1.0 ug DNA
EUR 154

Tmem72 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6630003 1.0 ug DNA
EUR 154

Tmem72 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6630004 1.0 ug DNA
EUR 154

Tmem72 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3780402 1.0 ug DNA
EUR 154

Tmem72 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3780403 1.0 ug DNA
EUR 154

Tmem72 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3780404 1.0 ug DNA
EUR 154

TMEM72 sgRNA CRISPR Lentivector (Human) (Target 1)

K2393102 1.0 ug DNA
EUR 154

TMEM72 sgRNA CRISPR Lentivector (Human) (Target 2)

K2393103 1.0 ug DNA
EUR 154

TMEM72 sgRNA CRISPR Lentivector (Human) (Target 3)

K2393104 1.0 ug DNA
EUR 154

 

Tmem72 Rabbit Polyclonal Antibody