SMC3 Rabbit Polyclonal Antibody

SMC3 Rabbit Polyclonal Antibody


SMC3 Rabbit pAb

A18402-100ul 100 ul
EUR 308

SMC3 Rabbit pAb

A18402-200ul 200 ul
EUR 459

SMC3 Rabbit pAb

A18402-20ul 20 ul
EUR 183

SMC3 Rabbit pAb

A18402-50ul 50 ul
EUR 223

Anti-SMC3 Rabbit Monoclonal Antibody

M01930 100ug/vial
EUR 397
Description: Rabbit Monoclonal SMC3 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

SMC3 antibody

70R-20399 50 ul
EUR 435
Description: Rabbit polyclonal SMC3 antibody

SMC3 antibody

10R-2960 100 ug
EUR 282
Description: Rat monoclonal SMC3 antibody

SMC3 Antibody

49448-100ul 100ul
EUR 333

SMC3 Antibody

49448-50ul 50ul
EUR 239

SMC3 Antibody

45067-100ul 100ul
EUR 252

SMC3 Antibody

45067-50ul 50ul
EUR 187

SMC3 Antibody

DF7558 200ul
EUR 304
Description: SMC3 Antibody detects endogenous levels of total SMC3.

SMC3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SMC3. Recognizes SMC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SMC3 Antibody

ABD7558 100 ug
EUR 438

Smc3/ Rat Smc3 ELISA Kit

ELI-42285r 96 Tests
EUR 886

SMC3 Conjugated Antibody

C49448 100ul
EUR 397

SMC3 Conjugated Antibody

C45067 100ul
EUR 397

anti- SMC3 antibody

FNab08017 100µg
EUR 548.75
  • Immunogen: structural maintenance of chromosomes 3
  • Uniprot ID: Q9UQE7
  • Gene ID: 9126
  • Research Area: Epigenetics, Cell Division and Proliferation, Signal Transduction, Metabolism
Description: Antibody raised against SMC3

Anti-SMC3 antibody

PAab08017 100 ug
EUR 386

Anti-SMC3 Antibody

PB9746 100ug/vial
EUR 334

Anti-SMC3 antibody

STJ11100356 100 µl
EUR 277

Anti-SMC3 antibody

STJ190157 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SMC3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA16107 50 ul
EUR 363
Description: Mouse polyclonal to SMC3


YF-PA16108 50 ug
EUR 363
Description: Mouse polyclonal to SMC3


YF-PA16109 100 ul
EUR 403
Description: Rabbit polyclonal to SMC3

SMC3 recombinant monoclonal antibody

A5283 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human SMC3 for WB,ELISA

Rabbit Anti-SMC3 monoclonal antibody, clone KN21-86

CABT-L918 100 ul
EUR 777

SMC3 cloning plasmid

CSB-CL891469HU-10ug 10ug
EUR 1290
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3654
  • Sequence: atgtacataaagcaggtgattatccagggttttcgaagttacagagatcaaacaattgtagatcccttcagttcaaaacataatgtgattgtgggcagaaatggatctggaaaaagtaaccttttttatgcaattcagtttgttctcagtgatgagtttagtcatcttcgtccag
  • Show more
Description: A cloning plasmid for the SMC3 gene.

SMC3 Blocking Peptide

DF7558-BP 1mg
EUR 195


PVT18959 2 ug
EUR 231

Anti-SMC3 (1G1)

YF-MA16676 100 ug
EUR 363
Description: Mouse monoclonal to SMC3

Anti-SMC3 (2F11)

YF-MA16677 100 ug
EUR 363
Description: Mouse monoclonal to SMC3

Anti-SMC3 Antibody (monoclonal, 4C12)

M01930-1 100ug/vial
EUR 334

Mouse Smc3 ELISA KIT

ELI-19977m 96 Tests
EUR 865


EF003060 96 Tests
EUR 689


ELI-52347b 96 Tests
EUR 928

Human SMC3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SMC3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-39431h 96 Tests
EUR 824

Structural Maintenance Of Chromosomes Protein 3 (SMC3) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMC3 (Ser994~Glu1181)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Structural Maintenance Of Chromosomes Protein 3 (SMC3)

Structural Maintenance Of Chromosomes Protein 3 (SMC3) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMC3 (Ser994~Glu1181)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Structural Maintenance Of Chromosomes Protein 3 (SMC3). This antibody is labeled with APC.

Structural Maintenance Of Chromosomes Protein 3 (SMC3) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMC3 (Ser994~Glu1181)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Structural Maintenance Of Chromosomes Protein 3 (SMC3). This antibody is labeled with Biotin.

Structural Maintenance Of Chromosomes Protein 3 (SMC3) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMC3 (Ser994~Glu1181)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Structural Maintenance Of Chromosomes Protein 3 (SMC3). This antibody is labeled with Cy3.

Structural Maintenance Of Chromosomes Protein 3 (SMC3) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMC3 (Ser994~Glu1181)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Structural Maintenance Of Chromosomes Protein 3 (SMC3). This antibody is labeled with FITC.

Structural Maintenance Of Chromosomes Protein 3 (SMC3) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMC3 (Ser994~Glu1181)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Structural Maintenance Of Chromosomes Protein 3 (SMC3). This antibody is labeled with HRP.

Structural Maintenance Of Chromosomes Protein 3 (SMC3) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMC3 (Ser994~Glu1181)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Structural Maintenance Of Chromosomes Protein 3 (SMC3). This antibody is labeled with PE.

Structural Maintenance of Chromosomes 3 (SMC3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Smc3 ORF Vector (Rat) (pORF)

ORF076692 1.0 ug DNA
EUR 506

SMC3 ORF Vector (Human) (pORF)

ORF009796 1.0 ug DNA
EUR 95

Smc3 ORF Vector (Mouse) (pORF)

ORF057965 1.0 ug DNA
EUR 506

Structural Maintenance Of Chromosomes Protein 3 (SMC3) Polyclonal Antibody (Human), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMC3 (Ser994~Glu1181)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Structural Maintenance Of Chromosomes Protein 3 (SMC3). This antibody is labeled with APC-Cy7.

Structural Maintenance of Chromosomes Protein 3 (SMC3) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Structural Maintenance of Chromosomes Protein 3 (SMC3) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Structural Maintenance of Chromosomes Protein 3 (SMC3) Antibody

abx122463-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Structural Maintenance of Chromosomes Protein 3 (SMC3) Antibody

abx028345-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Structural Maintenance of Chromosomes Protein 3 (SMC3) Antibody

abx028345-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Structural Maintenance of Chromosomes Protein 3 (SMC3) Antibody

abx238017-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Smc3 sgRNA CRISPR Lentivector set (Mouse)

K4775801 3 x 1.0 ug
EUR 339

Smc3 sgRNA CRISPR Lentivector set (Rat)

K6829501 3 x 1.0 ug
EUR 339

SMC3 sgRNA CRISPR Lentivector set (Human)

K2200101 3 x 1.0 ug
EUR 339

Structural Maintenance of Chromosomes Protein 3 (SMC3) Antibody (Biotin)

  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Smc3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4775802 1.0 ug DNA
EUR 154

Smc3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4775803 1.0 ug DNA
EUR 154

Smc3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4775804 1.0 ug DNA
EUR 154

Smc3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6829502 1.0 ug DNA
EUR 154

Smc3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6829503 1.0 ug DNA
EUR 154

Smc3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6829504 1.0 ug DNA
EUR 154

SMC3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2200102 1.0 ug DNA
EUR 154

SMC3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2200103 1.0 ug DNA
EUR 154

SMC3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2200104 1.0 ug DNA
EUR 154

SMC3 Protein Vector (Rat) (pPB-C-His)

PV306766 500 ng
EUR 1191

SMC3 Protein Vector (Rat) (pPB-N-His)

PV306767 500 ng
EUR 1191

SMC3 Protein Vector (Rat) (pPM-C-HA)

PV306768 500 ng
EUR 1191

SMC3 Protein Vector (Rat) (pPM-C-His)

PV306769 500 ng
EUR 1191

SMC3 Protein Vector (Human) (pPB-C-His)

PV039181 500 ng
EUR 329

SMC3 Protein Vector (Human) (pPB-N-His)

PV039182 500 ng
EUR 329

SMC3 Protein Vector (Human) (pPM-C-HA)

PV039183 500 ng
EUR 329

SMC3 Protein Vector (Human) (pPM-C-His)

PV039184 500 ng
EUR 329

SMC3 Protein Vector (Mouse) (pPB-C-His)

PV231858 500 ng
EUR 1065


SMC3 Rabbit Polyclonal Antibody