RNF6 Rabbit Polyclonal Antibody
RNF6 Polyclonal Antibody |
ABP60222-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RNF6 protein at amino acid sequence of 470-550
- Applications tips:
|
Description: A polyclonal antibody for detection of RNF6 from Human. This RNF6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF6 protein at amino acid sequence of 470-550 |
RNF6 Polyclonal Antibody |
ES9106-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RNF6 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RNF6 Polyclonal Antibody |
ES9106-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RNF6 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RNF6 Rabbit pAb |
A14572-100ul |
Abclonal |
100 ul |
EUR 308 |
RNF6 Rabbit pAb |
A14572-200ul |
Abclonal |
200 ul |
EUR 459 |
RNF6 Rabbit pAb |
A14572-20ul |
Abclonal |
20 ul |
EUR 183 |
RNF6 Rabbit pAb |
A14572-50ul |
Abclonal |
50 ul |
EUR 223 |
RNF6 antibody |
20R-1156 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal RNF6 antibody |
RNF6 antibody |
70R-19930 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RNF6 antibody |
RNF6 antibody |
70R-2741 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RNF6 antibody |
RNF6 antibody |
70R-3063 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RNF6 antibody |
RNF6 Antibody |
45567-100ul |
SAB |
100ul |
EUR 252 |
RNF6 Antibody |
45567-50ul |
SAB |
50ul |
EUR 187 |
RNF6 Antibody |
1-CSB-PA897080LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
RNF6 Antibody |
DF8890 |
Affbiotech |
200ul |
EUR 304 |
Description: RNF6 Antibody detects endogenous levels of total RNF6. |
RNF6 Antibody |
1-CSB-PA019896GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF |
RNF6 Conjugated Antibody |
C45567 |
SAB |
100ul |
EUR 397 |
anti- RNF6 antibody |
FNab07360 |
FN Test |
100µg |
EUR 585 |
- Immunogen: ring finger protein(C3H2C3 type) 6
- Uniprot ID: Q9Y252
- Gene ID: 6049
- Research Area: Epigenetics, Developmental biology
|
Description: Antibody raised against RNF6 |
Anti-RNF6 antibody |
STJ116783 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene contains a RING-H2 finger motif. Deletions and mutations in this gene were detected in esophageal squamous cell carcinoma (ESCC), suggesting that this protein may be a potential tumor suppressor. Studies of the mouse counterpart suggested a role of this protein in the transcription regulation that controls germinal differentiation. Multiple alternatively spliced transcript variants encoding the same protein are observed. |
Anti-RNF6 antibody |
STJ190264 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RNF6 |
RNF6 siRNA |
20-abx931804 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNF6 siRNA |
20-abx931805 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-RNF6 |
YF-PA14404 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to RNF6 |
anti-RNF6 |
YF-PA14405 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to RNF6 |
anti-RNF6 |
YF-PA24587 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to RNF6 |
RNF6 Antibody, HRP conjugated |
1-CSB-PA897080LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RNF6 Antibody, FITC conjugated |
1-CSB-PA897080LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RNF6 Antibody, Biotin conjugated |
1-CSB-PA897080LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
RNF6 Blocking Peptide |
33R-5331 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF6 antibody, catalog no. 70R-2741 |
RNF6 Blocking Peptide |
33R-9514 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF6 antibody, catalog no. 70R-3063 |
RNF6 Blocking Peptide |
33R-5861 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF6 antibody, catalog no. 20R-1156 |
RNF6 cloning plasmid |
CSB-CL897080HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2058
- Sequence: atgaatcagtctagatcgagatcagatggtggcagtgaagaaaccttacctcaagaccataatcatcatgaaaatgagagaagatggcagcaagagcgtctccacagagaagaggcctattatcagtttattaatgaactcaatgatgaagattatcggcttatgagagaccata
- Show more
|
Description: A cloning plasmid for the RNF6 gene. |
RNF6 Blocking Peptide |
DF8890-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-RNF6 (3B1) |
YF-MA15219 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to RNF6 |
Anti-RNF6 (6D5) |
YF-MA15220 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to RNF6 |
Mouse E3 ubiquitin- protein ligase RNF6, Rnf6 ELISA KIT |
ELI-15185m |
Lifescience Market |
96 Tests |
EUR 865 |
Human E3 ubiquitin- protein ligase RNF6, RNF6 ELISA KIT |
ELI-30259h |
Lifescience Market |
96 Tests |
EUR 824 |
RNF6 Rabbit Polyclonal Antibody