RIPK2 (Phospho-Ser176) Antibody
Phospho-RIPK2 (Ser176) Antibody |
A1724-100 |
Biovision |
|
EUR 479 |
RIPK2 (Phospho-Ser176) Antibody |
12120-100ul |
SAB |
100ul |
EUR 252 |
RIPK2 (Phospho-Ser176) Antibody |
12120-50ul |
SAB |
50ul |
EUR 187 |
Phospho-RIPK2 (Ser176) Antibody |
CSB-PA231579- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
Description: A polyclonal antibody against Phospho-RIPK2 (Ser176). Recognizes Phospho-RIPK2 (Ser176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100 |
Phospho-RIPK2 (Ser176) Antibody |
CSB-PA231579-100ul |
Cusabio |
100ul |
EUR 362 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
Description: A polyclonal antibody against Phospho-RIPK2 (Ser176). Recognizes Phospho-RIPK2 (Ser176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100 |
RIPK2 (Phospho-Ser176) Polyclonal Antibody |
ABP60180-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein |
RIPK2 (Phospho-Ser176) Polyclonal Antibody |
ABP60180-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein |
RIPK2 (Phospho-Ser176) Polyclonal Antibody |
ABP60180-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein |
Anti-Phospho-RIPK2 (Ser176) antibody |
STJ99600 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Phospho-RIPK2 (Ser176). |
RIPK2 antibody (Ser176) |
70R-32731 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal RIPK2 antibody (Ser176) |
Phospho-RIPK2(Ser176) Blocking Peptide |
AF0049-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK2 (Phospho-Ser176) Colorimetric Cell-Based ELISA Kit |
EKC2582 |
BosterBio |
100ul |
EUR 572 |
Phospho-RIPK2 (Ser176) Colorimetric Cell-Based ELISA Kit (OKAG02134) |
OKAG02134 |
Aviva Systems Biology |
2 x 96 Wells |
EUR 740 |
Description: Description of target: ;Species reactivity: Human: S176, Mouse: S176;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: Phospho Detection Method: Colorimetric 450 nm;Sensitivity: |
Receptor Interacting Serine Threonine Kinase 2 Phospho-Ser176 (RIPK2 pS176) Antibody |
20-abx325915 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 2 Phospho-Ser176 (RIPK2 pS176) Antibody |
abx333065-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
Phospho-YB1 (Ser176) Antibody |
AF7332 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-YB1 (Ser176) Antibody detects endogenous levels of YB1 only when phosphorylated at Ser176. |
YB1 (Phospho-Ser176) Antibody |
13181-100ul |
SAB |
100ul |
EUR 252 |
YB1 (Phospho-Ser176) Antibody |
13181-50ul |
SAB |
50ul |
EUR 187 |
YB1 (Phospho-Ser176) Conjugated Antibody |
C13181 |
SAB |
100ul |
EUR 397 |
RIP2 (phospho Ser176) Polyclonal Antibody |
ES7873-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RIP2 (phospho Ser176) from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
RIP2 (phospho Ser176) Polyclonal Antibody |
ES7873-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RIP2 (phospho Ser176) from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
RIP2 (phospho Ser176) Polyclonal Antibody |
ABP56874-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
- Applications tips:
|
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176 |
RIP2 (phospho Ser176) Polyclonal Antibody |
ABP56874-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
- Applications tips:
|
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176 |
RIP2 (phospho Ser176) Polyclonal Antibody |
ABP56874-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
- Applications tips:
|
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176 |
Phospho-RIPK2 (Ser531) Antibody |
AF7118 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-RIPK2 (Ser531) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Ser531. |
RIPK2 (Phospho-Ser531) Antibody |
12981-100ul |
SAB |
100ul |
EUR 252 |
RIPK2 (Phospho-Ser531) Antibody |
12981-50ul |
SAB |
50ul |
EUR 187 |
RIPK2 (Phospho-Tyr381) Antibody |
12982-100ul |
SAB |
100ul |
EUR 252 |
RIPK2 (Phospho-Tyr381) Antibody |
12982-50ul |
SAB |
50ul |
EUR 187 |
Phospho-RIPK2 (S176) Antibody |
1-CSB-PA070142 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-RIPK2 (S176). Recognizes Phospho-RIPK2 (S176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
IKK?/? (phospho Ser176/177) Polyclonal Antibody |
ES4646-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IKK?/? (phospho Ser176/177) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
IKK?/? (phospho Ser176/177) Polyclonal Antibody |
ES4646-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IKK?/? (phospho Ser176/177) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
IKK alpha/beta antibody (Phospho-Ser176) |
70R-11103 |
Fitzgerald |
50 ug |
EUR 327 |
Description: Rabbit polyclonal IKK alpha/beta antibody for detection of the Phospho-Ser176 form of the IKK alpha/beta peptide. |
Phospho-CHUK/IKBKB (Ser176/177) Antibody |
CSB-PA983649- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
Description: A polyclonal antibody against Phospho-CHUK/IKBKB (Ser176/177). Recognizes Phospho-CHUK/IKBKB (Ser176/177) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
Phospho-CHUK/IKBKB (Ser176/177) Antibody |
CSB-PA983649-100ul |
Cusabio |
100ul |
EUR 362 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
Description: A polyclonal antibody against Phospho-CHUK/IKBKB (Ser176/177). Recognizes Phospho-CHUK/IKBKB (Ser176/177) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
Phospho-YB1 (Ser176) Blocking Peptide |
AF7332-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK2 (Phospho-Tyr381) Conjugated Antibody |
C12982 |
SAB |
100ul |
EUR 397 |
IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody |
ABP53647-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
- Applications tips:
|
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177 |
IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody |
ABP53647-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
- Applications tips:
|
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177 |
IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody |
ABP53647-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
- Applications tips:
|
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177 |
IKK- alpha/ beta (Phospho-Ser176/177) Antibody |
11931-100ul |
SAB |
100ul |
EUR 252 |
IKK- alpha/ beta (Phospho-Ser176/177) Antibody |
11931-50ul |
SAB |
50ul |
EUR 187 |
anti-IKK α/β (Phospho-Ser176) |
LF-PA20648 |
Abfrontier |
100 ul |
EUR 354 |
Description: Rabbit polyclonal to IKK α/β (Phospho-Ser176) |
RIPK2 (Phospho-Ser531) Polyclonal Conjugated Antibody |
C12981 |
SAB |
100ul |
EUR 397 |
Phospho-IKK alpha (Ser176) /IKK beta (Ser177) Antibody |
AF3014 |
Affbiotech |
200ul |
EUR 304 |
Description: Phospho-IKK- alpha (Ser176) /IKK- beta (Ser177) Antibody detects endogenous levels of IKK- alpha /IKK- beta only when phosphorylated at Serine 177. |
Phospho- IKK- alpha (Ser176) /IKK- beta (Ser177) Antibody |
ABF3014 |
Lifescience Market |
100 ug |
EUR 438 |
Phospho-RIPK2 (Ser531) Blocking Peptide |
AF7118-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK2 Antibody |
AF7618 |
Affbiotech |
200ul |
EUR 376 |
Description: RIPK2 Antibody detects endogenous levels of RIPK2. |
RIPK2 antibody |
70R-32732 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal RIPK2 antibody |
RIPK2 Antibody |
32675-100ul |
SAB |
100ul |
EUR 252 |
RIPK2 antibody |
70R-19904 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RIPK2 antibody |
RIPK2 antibody |
70R-10459 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal RIPK2 antibody |
RIPK2 Antibody |
DF6967 |
Affbiotech |
200ul |
EUR 304 |
Description: RIPK2 Antibody detects endogenous levels of total RIPK2. |
RIPK2 Antibody |
DF2641 |
Affbiotech |
200ul |
EUR 304 |
Description: RIPK2 antibody detects endogenous levels of total RIPK2. |
RIPK2 Antibody |
1-CSB-PA070143 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
RIPK2 Antibody |
1-CSB-PA019736ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
RIPK2 Antibody |
1-CSB-PA019736GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
RIPK2 Antibody |
1-CSB-PA019736LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500 |
IKK- alpha/ beta (Phospho-Ser176/177) Polyclonal Conjugated Antibody |
C11931 |
SAB |
100ul |
EUR 397 |
RIPK2 Conjugated Antibody |
C32675 |
SAB |
100ul |
EUR 397 |
anti- RIPK2 antibody |
FNab07314 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: receptor-interacting serine-threonine kinase 2
- Uniprot ID: O43353
- Gene ID: 8767
- Research Area: Immunology, Signal Transduction, Metabolism
|
Description: Antibody raised against RIPK2 |
RIPK2 (pS176) Antibody |
abx011477-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
RIPK2 (pS176) Antibody |
abx011478-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
RIPK2 Polyclonal Antibody |
A54388 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Anti-RIPK2 antibody |
STJ25358 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli. |
Anti-RIPK2 antibody |
STJ115343 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli. |
IKK a/b antibody (Ser176) |
70R-37438 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Rabbit Polyclonal IKK a/b antibody (Ser176) |
IKK alpha/beta antibody (Ser176) |
70R-31308 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal IKK alpha/beta antibody (Ser176) |
Phospho-IKK alpha (Ser176) /IKK beta (Ser177) Blocking Peptide |
AF3014-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK2 siRNA |
20-abx931564 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RIPK2 siRNA |
20-abx931565 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RIPK2 protein |
30R-2861 |
Fitzgerald |
5 ug |
EUR 503 |
Description: Purified recombinant Human RIPK2 protein |
RIPK2 Antibody, HRP conjugated |
1-CSB-PA019736LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RIPK2 Antibody, FITC conjugated |
1-CSB-PA019736LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RIPK2 Antibody, Biotin conjugated |
1-CSB-PA019736LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-RIP2/RIPK2 Antibody |
PA1861 |
BosterBio |
100ug/vial |
EUR 294 |
IKK-alpha (Phospho-Ser176) /IKK-beta (Phospho-Ser177) Colorimetric Cell-Based ELISA Kit |
EKC2043 |
BosterBio |
100ul |
EUR 572 |
RIPK2 Blocking Peptide |
AF7618-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK2 cloning plasmid |
CSB-CL019736HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1623
- Sequence: atgaacggggaggccatctgcagcgccctgcccaccattccctaccacaaactcgccgacctgcgctacctgagccgcggcgcctctggcactgtgtcgtccgcccgccacgcagactggcgcgtccaggtggccgtgaagcacctgcacatccacactccgctgctcgacagtg
- Show more
|
Description: A cloning plasmid for the RIPK2 gene. |
RIPK2 Rabbit pAb |
A13381-100ul |
Abclonal |
100 ul |
EUR 308 |
RIPK2 Rabbit pAb |
A13381-200ul |
Abclonal |
200 ul |
EUR 459 |
RIPK2 Rabbit pAb |
A13381-20ul |
Abclonal |
20 ul |
EUR 183 |
RIPK2 Rabbit pAb |
A13381-50ul |
Abclonal |
50 ul |
EUR 223 |
RIPK2 Rabbit pAb |
A2498-100ul |
Abclonal |
100 ul |
EUR 308 |
RIPK2 Rabbit pAb |
A2498-200ul |
Abclonal |
200 ul |
EUR 459 |
RIPK2 Rabbit pAb |
A2498-20ul |
Abclonal |
20 ul |
EUR 183 |
RIPK2 (Phospho-Ser176) Antibody