RIPK2 (Phospho-Ser176) Antibody

RIPK2 (Phospho-Ser176) Antibody


Phospho-RIPK2 (Ser176) Antibody

EUR 479

RIPK2 (Phospho-Ser176) Antibody

12120-100ul 100ul
EUR 252

RIPK2 (Phospho-Ser176) Antibody

12120-50ul 50ul
EUR 187

Phospho-RIPK2 (Ser176) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-RIPK2 (Ser176). Recognizes Phospho-RIPK2 (Ser176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-RIPK2 (Ser176) Antibody

CSB-PA231579-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-RIPK2 (Ser176). Recognizes Phospho-RIPK2 (Ser176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

RIPK2 (Phospho-Ser176) Polyclonal Antibody

ABP60180-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein

RIPK2 (Phospho-Ser176) Polyclonal Antibody

ABP60180-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein

RIPK2 (Phospho-Ser176) Polyclonal Antibody

ABP60180-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein

Anti-Phospho-RIPK2 (Ser176) antibody

STJ99600 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-RIPK2 (Ser176).

RIPK2 antibody (Ser176)

70R-32731 100 ug
EUR 327
Description: Rabbit polyclonal RIPK2 antibody (Ser176)

Phospho-RIPK2(Ser176) Blocking Peptide

AF0049-BP 1mg
EUR 195

RIPK2 (Phospho-Ser176) Colorimetric Cell-Based ELISA Kit

EKC2582 100ul
EUR 572

Phospho-RIPK2 (Ser176) Colorimetric Cell-Based ELISA Kit (OKAG02134)

OKAG02134 2 x 96 Wells
EUR 740
Description: Description of target: ;Species reactivity: Human: S176, Mouse: S176;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: Phospho
Detection Method: Colorimetric 450 nm;Sensitivity:

Receptor Interacting Serine Threonine Kinase 2 Phospho-Ser176 (RIPK2 pS176) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 Phospho-Ser176 (RIPK2 pS176) Antibody

abx333065-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Phospho-YB1 (Ser176) Antibody

AF7332 200ul
EUR 376
Description: Phospho-YB1 (Ser176) Antibody detects endogenous levels of YB1 only when phosphorylated at Ser176.

Phospho- RIP2 (Ser176) Antibody

ABF3730 100 ug
EUR 438

YB1 (Phospho-Ser176) Antibody

13181-100ul 100ul
EUR 252

YB1 (Phospho-Ser176) Antibody

13181-50ul 50ul
EUR 187

YB1 (Phospho-Ser176) Conjugated Antibody

C13181 100ul
EUR 397

RIP2 (phospho Ser176) Polyclonal Antibody

ES7873-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RIP2 (phospho Ser176) from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

RIP2 (phospho Ser176) Polyclonal Antibody

ES7873-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RIP2 (phospho Ser176) from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

RIP2 (phospho Ser176) Polyclonal Antibody

ABP56874-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
  • Applications tips:
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176

RIP2 (phospho Ser176) Polyclonal Antibody

ABP56874-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
  • Applications tips:
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176

RIP2 (phospho Ser176) Polyclonal Antibody

ABP56874-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
  • Applications tips:
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176

Phospho-RIPK2 (Ser531) Antibody

AF7118 200ul
EUR 376
Description: Phospho-RIPK2 (Ser531) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Ser531.

RIPK2 (Phospho-Ser531) Antibody

12981-100ul 100ul
EUR 252

RIPK2 (Phospho-Ser531) Antibody

12981-50ul 50ul
EUR 187

RIPK2 (Phospho-Tyr381) Antibody

12982-100ul 100ul
EUR 252

RIPK2 (Phospho-Tyr381) Antibody

12982-50ul 50ul
EUR 187

Phospho-RIPK2 (S176) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-RIPK2 (S176). Recognizes Phospho-RIPK2 (S176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

IKK?/? (phospho Ser176/177) Polyclonal Antibody

ES4646-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IKK?/? (phospho Ser176/177) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

IKK?/? (phospho Ser176/177) Polyclonal Antibody

ES4646-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IKK?/? (phospho Ser176/177) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

IKK alpha/beta antibody (Phospho-Ser176)

70R-11103 50 ug
EUR 327
Description: Rabbit polyclonal IKK alpha/beta antibody for detection of the Phospho-Ser176 form of the IKK alpha/beta peptide.

Phospho-CHUK/IKBKB (Ser176/177) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CHUK/IKBKB (Ser176/177). Recognizes Phospho-CHUK/IKBKB (Ser176/177) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-CHUK/IKBKB (Ser176/177) Antibody

CSB-PA983649-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CHUK/IKBKB (Ser176/177). Recognizes Phospho-CHUK/IKBKB (Ser176/177) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-YB1 (Ser176) Blocking Peptide

AF7332-BP 1mg
EUR 195

RIPK2 (Phospho-Tyr381) Conjugated Antibody

C12982 100ul
EUR 397

IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody

ABP53647-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
  • Applications tips:
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177

IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody

ABP53647-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
  • Applications tips:
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177

IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody

ABP53647-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
  • Applications tips:
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177

IKK- alpha/ beta (Phospho-Ser176/177) Antibody

11931-100ul 100ul
EUR 252

IKK- alpha/ beta (Phospho-Ser176/177) Antibody

11931-50ul 50ul
EUR 187

anti-IKK α/β (Phospho-Ser176)

LF-PA20648 100 ul
EUR 354
Description: Rabbit polyclonal to IKK α/β (Phospho-Ser176)

RIPK2 (Phospho-Ser531) Polyclonal Conjugated Antibody

C12981 100ul
EUR 397

Phospho-IKK alpha (Ser176) /IKK beta (Ser177) Antibody

AF3014 200ul
EUR 304
Description: Phospho-IKK- alpha (Ser176) /IKK- beta (Ser177) Antibody detects endogenous levels of IKK- alpha /IKK- beta only when phosphorylated at Serine 177.

Phospho- IKK- alpha (Ser176) /IKK- beta (Ser177) Antibody

ABF3014 100 ug
EUR 438

Phospho-RIPK2 (Ser531) Blocking Peptide

AF7118-BP 1mg
EUR 195

RIPK2 Antibody

AF7618 200ul
EUR 376
Description: RIPK2 Antibody detects endogenous levels of RIPK2.

RIPK2 antibody

70R-32732 100 ug
EUR 327
Description: Rabbit polyclonal RIPK2 antibody

RIPK2 Antibody

ABD2641 100 ug
EUR 438

RIPK2 Antibody

ABD6967 100 ug
EUR 438

RIPK2 Antibody

32675-100ul 100ul
EUR 252

RIPK2 antibody

70R-19904 50 ul
EUR 435
Description: Rabbit polyclonal RIPK2 antibody

RIPK2 antibody

70R-10459 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RIPK2 antibody

RIPK2 Antibody

DF6967 200ul
EUR 304
Description: RIPK2 Antibody detects endogenous levels of total RIPK2.

RIPK2 Antibody

DF2641 200ul
EUR 304
Description: RIPK2 antibody detects endogenous levels of total RIPK2.

RIPK2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RIPK2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RIPK2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RIPK2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

IKK- alpha/ beta (Phospho-Ser176/177) Polyclonal Conjugated Antibody

C11931 100ul
EUR 397

RIPK2 Conjugated Antibody

C32675 100ul
EUR 397

anti- RIPK2 antibody

FNab07314 100µg
EUR 548.75
  • Immunogen: receptor-interacting serine-threonine kinase 2
  • Uniprot ID: O43353
  • Gene ID: 8767
  • Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against RIPK2

RIPK2 (pS176) Antibody

abx011477-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RIPK2 (pS176) Antibody

abx011478-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RIPK2 Polyclonal Antibody

A54388 100 µg
EUR 570.55
Description: kits suitable for this type of research

Anti-RIPK2 antibody

PAab07314 100 ug
EUR 386

Anti-RIPK2 Antibody

STJ502801 100 µg
EUR 476

Anti-RIPK2 antibody

STJ25358 100 µl
EUR 277
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli.

Anti-RIPK2 antibody

STJ115343 100 µl
EUR 277
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli.

IKK a/b antibody (Ser176)

70R-37438 100 ug
EUR 349
Description: Rabbit Polyclonal IKK a/b antibody (Ser176)

IKK alpha/beta antibody (Ser176)

70R-31308 100 ug
EUR 327
Description: Rabbit polyclonal IKK alpha/beta antibody (Ser176)

Phospho-IKK alpha (Ser176) /IKK beta (Ser177) Blocking Peptide

AF3014-BP 1mg
EUR 195


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK2, Active

EUR 370

RIPK2 protein

30R-2861 5 ug
EUR 503
Description: Purified recombinant Human RIPK2 protein

RIPK2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RIPK2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RIPK2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-RIP2/RIPK2 Antibody

PA1861 100ug/vial
EUR 294

Anti-RIPK2 Antibody (Biotin)

STJ502802 100 µg
EUR 586

Anti-RIPK2 Antibody (FITC)

STJ502803 100 µg
EUR 586

IKK-alpha (Phospho-Ser176) /IKK-beta (Phospho-Ser177) Colorimetric Cell-Based ELISA Kit

EKC2043 100ul
EUR 572

RIPK2 Blocking Peptide

AF7618-BP 1mg
EUR 195

RIPK2 cloning plasmid

CSB-CL019736HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1623
  • Sequence: atgaacggggaggccatctgcagcgccctgcccaccattccctaccacaaactcgccgacctgcgctacctgagccgcggcgcctctggcactgtgtcgtccgcccgccacgcagactggcgcgtccaggtggccgtgaagcacctgcacatccacactccgctgctcgacagtg
  • Show more
Description: A cloning plasmid for the RIPK2 gene.

RIPK2 Rabbit pAb

A13381-100ul 100 ul
EUR 308

RIPK2 Rabbit pAb

A13381-200ul 200 ul
EUR 459

RIPK2 Rabbit pAb

A13381-20ul 20 ul
EUR 183

RIPK2 Rabbit pAb

A13381-50ul 50 ul
EUR 223

RIPK2 Rabbit pAb

A2498-100ul 100 ul
EUR 308

RIPK2 Rabbit pAb

A2498-200ul 200 ul
EUR 459

RIPK2 Rabbit pAb

A2498-20ul 20 ul
EUR 183


RIPK2 (Phospho-Ser176) Antibody