Reconstitution and biochemical assays of an active human histone pre-mRNA 3'-end processing machinery

Reconstitution and biochemical assays of an active human histone pre-mRNA 3′-end processing machinery

Posted on by HefeiLifang
In animal cells, replication-dependent histone pre-mRNAs are processed on the 3′-end by an endonucleolytic cleavage carried out by the U7 snRNP, a machinery that comprises the U7 snRNA and many protein subunits. Studies on the composition of this machinery and understanding of its position in 3′-end processing had been enormously facilitated by the event of an in vitro system using nuclear extracts from mammalian cells 35 years in the past and later from Drosophila cells.
Most lately, recombinant expression and purification of the elements of the machinery have enabled the total reconstitution of an active machinery and its complicated with a mannequin pre-mRNA substrate, utilizing 13 proteins and 2 RNAs, and the willpower of the construction of this active machinery. This chapter presents protocols for making ready nuclear extracts containing endogenous processing machinery, for assembling semi-recombinant and totally reconstituted machineries, and for histone pre-mRNA 3′-end processing assays with these samples.

Optimization of biochemical sulfide potential (BSP) assay for anaerobic biodegradability evaluation

The anaerobic biodegradability evaluation (biodegradation extent and kinetics) of natural wastes is vital for optimum design and evaluating therapy efficiencies for anaerobic therapy applied sciences. The biochemical sulfide potential (BSP) assay has beforehand demonstrated the benefits of its time effectivity and measurement accuracy for biologically assessing substrate degradability, whereas its software is proscribed by undefined operational parameters. In this research, the BSP assay was additional optimized via a scientific investigation of a vital parameter, inoculum-to-substrate ratio (ISR), and the relevant kinetic mannequin to unravel the potential use of BSP assays for anaerobic waste therapy.
Under two collection of experimental eventualities, the widespread ISR ranges of 0.5-4.0 (based mostly on the standard BMP assay) and excessive ISRs (as little as 0.1) had been studied, by which the benefit of a BSP assay on excessive ISRs was highlighted. Meanwhile, the underlying trigger and mechanism for biodegradability discrepancies beneath totally different ISRs (0.1-6.0) had been additional investigated.
Reconstitution and biochemical assays of an active human histone pre-mRNA 3'-end processing machinery
The extracellular polymeric substance (EPS) characterization of residual organics and the two-substrate first-order hydrolysis mannequin analyses revealed that the hydrolysis course of of slowly-biodegradable organics fraction was hindered beneath improper ISR circumstances. Furthermore, the Cone mannequin was evaluated as extra acceptable for biodegradation kinetics evaluation in BSP assays among the many 5 widespread kinetic fashions (i.e., Exponential, Fitzhugh, Cone, Transference, and modified Gompertz fashions). Overall, the outcomes present basic steerage on designing constant BSP assays and put a step ahead in standardizing the BSP assay for anaerobic biodegradability assessments.

Assessment of structural protein expression by FTIR and biochemical assays as biomarkers of metabolites response in gastric and colon most cancers

Colon and gastric cancers are the widespread benign varieties of cancers that are synchronous and metachronous neoplasms. In phrases of the development and progress of the illness, metabolic processes and differentiation in protein buildings have an vital position in for therapy of the illness. In this research we proposed to analyze the metabolic course of and the differentiation of protein secondary construction amongst colon and gastric most cancers in addition to wholesome controls utilizing biochemistry and Fourier Transform InfraRed spectroscopy (FTIR) strategies. For this goal, we measured blood serum of 133 sufferers, which had been performed upon oncology division (45 colon most cancers, 45 gastric most cancers and 43 management people).
The obtained spectroscopic outcomes and biochemical assays confirmed vital discount within the quantity of useful teams in most cancers teams opposite with whole protein measurements and construction of protein variations between colon and gastric cancers. Differentiations had been seen in serum ranges of CEA, CA-125, CA-15-3, CA-19-9 AFP (Alpha fetoprotein) of gastric and colon most cancers sufferers in addition to in amide III and secondly described amide I areas. Our findings recommend that amide I bonds in colon most cancers cells will be useful in prognosis of colon most cancers.
Indeed, our outcomes confirmed that metabolic processes had been greater in gastric most cancers group than in colon most cancers. Hence, FTIR spectroscopy and curve-fitting evaluation of amide I profile will be efficiently utilized as instruments for figuring out quantitative and qualitative adjustments of proteins in human cancerous blood serum. However, what is essential, in PCA evaluation we see, that the scatter plot of PC1 (variability 80%) and PC2 (variability 15%) present that the information associated to the management and two most cancers teams are clustered along with totally different magnitudes and instructions.

High-Throughput Label-Free Biochemical Assays Using Infrared Matrix-Assisted Desorption Electrospray Ionization Mass Spectrometry

Mass spectrometry (MS) can present excessive sensitivity and specificity for biochemical assays with out the requirement of labels, eliminating the danger of assay interference. However, its use had been restricted to lower-throughput assays because of the want for chromatography to beat ion suppression from the pattern matrix.
Direct evaluation with out chromatography has the potential for top throughput if sensitivity is ample regardless of the presence of a matrix. Here, we report and show a novel direct evaluation high-throughput MS system based mostly on infrared matrix-assisted desorption electrospray ionization (IR-MALDESI) that has a possible acquisition price of 33 spectra/s.

Human A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
RD-ADAM10-Hu-48Tests 48 Tests
EUR 478

Human A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
RD-ADAM10-Hu-96Tests 96 Tests
EUR 662

Rat A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
RD-ADAM10-Ra-48Tests 48 Tests
EUR 511

Rat A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
RD-ADAM10-Ra-96Tests 96 Tests
EUR 709

Human A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
RDR-ADAM10-Hu-48Tests 48 Tests
EUR 500

Human A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
RDR-ADAM10-Hu-96Tests 96 Tests
EUR 692

Rat A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
RDR-ADAM10-Ra-48Tests 48 Tests
EUR 534

Rat A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
RDR-ADAM10-Ra-96Tests 96 Tests
EUR 742

Adam10/ Rat Adam10 ELISA Kit
ELI-02616r 96 Tests
EUR 886

Anti-ADAM10/ADAM10 Antibody
PA1535 100ug/vial
EUR 294

ADAM10
PR27192 2 ug
EUR 191

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

T&A Cloning Kits
FYC001-20P 1 vial Ask for price

Basic Cytotoxicity Test Kits
CT17001 125 Tests
EUR 409

Basic Cytotoxicity Test Kits
CT17002 250 Tests
EUR 650

Total Cytotoxicity Test Kits
CT17003 125 Tests
EUR 513

Total Cytotoxicity Test Kits
CT17004 250 Tests
EUR 813

Necrosis vs Apoptosis Kits
KF17371 50-100 Tests
EUR 435

Necrosis vs Apoptosis Kits
KF17372 100-200 Tests
EUR 768

Pipette Stand Starter Kits
P7700-S1 1 PC
EUR 507.83
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Pipette Stand Starter Kits
P7700-S2 1 PC
EUR 526.1
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Human ADAM10 ELISA Kit
EHA0734 96Tests
EUR 521

Human ADAM10 ELISA Kit
ELA-E0766h 96 Tests
EUR 824

Goat ADAM10 ELISA Kit
EGTA0734 96Tests
EUR 521

Canine ADAM10 ELISA Kit
ECA0734 96Tests
EUR 521

Chicken ADAM10 ELISA Kit
ECKA0734 96Tests
EUR 521

Bovine ADAM10 ELISA Kit
EBA0734 96Tests
EUR 521

Anserini ADAM10 ELISA Kit
EAA0734 96Tests
EUR 521

Mouse Adam10 ELISA KIT
ELI-02614m 96 Tests
EUR 865

Bovine ADAM10 ELISA KIT
ELI-02617b 96 Tests
EUR 928

Human ADAM10 ELISA KIT
ELI-02618h 96 Tests
EUR 824

ADAM10 ELISA KIT|Human
EF001085 96 Tests
EUR 689

Rat ADAM10 ELISA Kit
ERA0734 96Tests
EUR 521

Rabbit ADAM10 ELISA Kit
ERTA0734 96Tests
EUR 521

Sheep ADAM10 ELISA Kit
ESA0734 96Tests
EUR 521

Porcine ADAM10 ELISA Kit
EPA0734 96Tests
EUR 521

Mouse ADAM10 ELISA Kit
EMA0734 96Tests
EUR 521

Monkey ADAM10 ELISA Kit
EMKA0734 96Tests
EUR 521

ADAM10 Antibody
AF5294 200ul
EUR 304
Description: ADAM10 Antibody detects endogenous levels of total ADAM10.

ADAM10 siRNA
20-abx906699
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAM10 siRNA
20-abx906700
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAM10 (Human)
GT15078 100 ug
EUR 526

ADAM10 (Mouse)
GT15079 100 ug
EUR 526

ADAM10 Antibody
ABF5294 100 ug
EUR 438

ADAM10 Antibody
36038-100ul 100ul
EUR 252

ADAM10 Antibody
49473-100ul 100ul
EUR 333

ADAM10 Antibody
49473-50ul 50ul
EUR 239

ADAM10 Antibody
3201-100
EUR 338

ADAM10 antibody
10R-1576 100 ug
EUR 512
Description: Mouse monoclonal ADAM10 antibody

ADAM10 Antibody
24044-100ul 100ul
EUR 390

ADAM10 antibody
70R-14074 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal ADAM10 antibody

ADAM10 antibody
70R-11689 100 ug
EUR 447
Description: Rabbit polyclonal ADAM10 antibody

ADAM10 Antibody
1-CSB-PA909378
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAM10. Recognizes ADAM10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ADAM10 Antibody
1-CSB-PA000013
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADAM10. Recognizes ADAM10 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

ADAM10 Antibody
1-CSB-PA001273LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAM10. Recognizes ADAM10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ADAM10 Antibody
1-CSB-PA069457
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAM10. Recognizes ADAM10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MitoPT™ TMRE & TMRM Kits
KF17358 500 Test
EUR 479

MitoPT™ TMRE & TMRM Kits
KF17359 500 Test
EUR 479

Rat Neural Stem Cell Kits
PC37123 1 X 10(6) *minimum order 6 vials*
EUR 957

HISTAR DETECTION SYSTEM Kits (OKSA11259)
OKSA11259 50 Tests
EUR 565
Description: Description of target: HISTAR DETECTION SYSTEM;Species reactivity: ;Application: IHC-AFF, IHC-FFPE;Assay info: ;Sensitivity:

HISTAR DETECTION SYSTEM Kits (OKSA11260)
OKSA11260 150 Tests
EUR 1335
Description: Description of target: HISTAR DETECTION SYSTEM;Species reactivity: ;Application: IHC-AFF, IHC-FFPE;Assay info: ;Sensitivity:

HISTAR DETECTION SYSTEM Kits (OKSA11261)
OKSA11261 500 Tests
EUR 2019
Description: Description of target: HISTAR DETECTION SYSTEM;Species reactivity: ;Application: IHC-AFF, IHC-FFPE;Assay info: ;Sensitivity:

Guinea Pig ADAM10 ELISA Kit
EGA0734 96Tests
EUR 521

ADAM10 ELISA Kit (Human) (OKAN05106)
OKAN05106 96 Wells
EUR 792
Description: Description of target: Members of the ADAM family are cell surface proteins with a unique structure possessing both potential adhesion and protease domains. This gene encodes and ADAM family member that cleaves many proteins including TNF-alpha and E-cadherin. Alternate splicing results in multiple transcript variants encoding different proteins that may undergo similar processing.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28 pg/mL

ADAM10 ELISA Kit (Rat) (OKAN05931)
OKAN05931 96 Wells
EUR 792
Description: Description of target: may act as a disintegrin-metalloprotease related to the reprolysin family [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 27 pg/mL

ADAM10 ELISA Kit (Human) (OKCD06783)
OKCD06783 96 Wells
EUR 753
Description: Description of target: Members of the ADAM family are cell surface proteins with a unique structure possessing both potential adhesion and protease domains. This gene encodes and ADAM family member that cleaves many proteins including TNF-alpha and E-cadherin. Alternate splicing results in multiple transcript variants encoding different proteins that may undergo similar processing.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 28pg/mL

ADAM10 ELISA Kit (Rat) (OKCD06785)
OKCD06785 96 Wells
EUR 818
Description: Description of target: Cleaves the membrane-bound precursor of TNF-alpha to its mature soluble form. Responsible for the proteolytical release of soluble JAM3 from endothelial cells surface. Responsible for the proteolytic release of several other cell-surface proteins, including heparin-binding epidermal growth-like factor, ephrin-A2, CD44, CDH2 and for constitutive and regulated alpha-secretase cleavage of amyloid precursor protein (APP). Contributes to the normal cleavage of the cellular prion protein. Involved in the cleavage of the adhesion molecule L1 at the cell surface and in released membrane vesicles, suggesting a vesicle-based protease activity. Controls also the proteolytic processing of Notch and mediates lateral inhibition during neurogenesis. Responsible for the FasL ectodomain shedding and for the generation of the remnant ADAM10-processed FasL (FasL APL) transmembrane form. Also cleaves the ectodomain of the integral membrane proteins CORIN and ITM2B. May regulate the EFNA5-EPHA3 signaling.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 27pg/mL

ADAM10 ELISA Kit (Rat) (OKEH06386)
OKEH06386 96 Wells
EUR 662
Description: Description of target: Cleaves the membrane-bound precursor of TNF-alpha to its mature soluble form. Responsible for the proteolytical release of soluble JAM3 from endothelial cells surface. Responsible for the proteolytic release of several other cell-surface proteins, including heparin-binding epidermal growth-like factor, ephrin-A2, CD44, CDH2 and for constitutive and regulated alpha-secretase cleavage of amyloid precursor protein (APP). Contributes to the normal cleavage of the cellular prion protein. Involved in the cleavage of the adhesion molecule L1 at the cell surface and in released membrane vesicles, suggesting a vesicle-based protease activity. Controls also the proteolytic processing of Notch and mediates lateral inhibition during neurogenesis. Responsible for the FasL ectodomain shedding and for the generation of the remnant ADAM10-processed FasL (FasL APL) transmembrane form. Also cleaves the ectodomain of the integral membrane proteins CORIN and ITM2B. May regulate the EFNA5-EPHA3 signaling.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

ADAM10 ELISA Kit (Mouse) (OKEH06827)
OKEH06827 96 Wells
EUR 779
Description: Description of target: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero with multiple defects of the developing central nervous system, somites, and cardiovascular system.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.081 ng/mL

ADAM10 ELISA Kit (Pig) (OKEH07468)
OKEH07468 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

ADAM10 Blocking Peptide
AF5294-BP 1mg
EUR 195

ADAM10 Conjugated Antibody
C49473 100ul
EUR 397

ADAM10 Conjugated Antibody
C36038 100ul
EUR 397

ADAM10 Polyclonal Antibody
ES1010-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ADAM10 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ADAM10 Polyclonal Antibody
ES1010-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ADAM10 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ADAM10 Polyclonal Antibody
ABP50011-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ADAM10 at AA range: 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of ADAM10 from Human. This ADAM10 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ADAM10 at AA range: 170-250

ADAM10 Polyclonal Antibody
ABP50011-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ADAM10 at AA range: 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of ADAM10 from Human. This ADAM10 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ADAM10 at AA range: 170-250

ADAM10 Polyclonal Antibody
ABP50011-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ADAM10 at AA range: 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of ADAM10 from Human. This ADAM10 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ADAM10 at AA range: 170-250

Human ADAM10 Protein
20-abx262305
  • EUR 328.00
  • EUR 5924.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Anti-ADAM10 Antibody
A00566-1 100ug/vial
EUR 294

ADAM10 Rabbit pAb
A10438-100ul 100 ul
EUR 308

ADAM10 Rabbit pAb
A10438-200ul 200 ul
EUR 459

ADAM10 Rabbit pAb
A10438-20ul 20 ul
EUR 183

ADAM10 Rabbit pAb
A10438-50ul 50 ul
EUR 223

ADAM10 Polyclonal Antibody
A58010 100 µg
EUR 570.55
Description: reagents widely cited

ADAM10 cloning plasmid
CSB-CL001273HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1539
  • Sequence: atggtgttgctgagagtgttaattctgctcctctcctgggcggcggggatgggaggtcagtatgggaatcctttaaataaatatatcagacattatgaaggattatcttacaatgtggattcattacaccaaaaacaccagcgtgccaaaagagcagtctcacatgaagaccaat
  • Show more
Description: A cloning plasmid for the ADAM10 gene.

ADAM10 (Human), CF
PR15036CF 20 ug
EUR 526

Anti-ADAM10 antibody
STJ90014 200 µl
EUR 197
Description: Rabbit polyclonal to ADAM10.

Anti-ADAM10 antibody
STJ112469 100 µl
EUR 277
Description: Members of the ADAM family are cell surface proteins with a unique structure possessing both potential adhesion and protease domains. This gene encodes and ADAM family member that cleaves many proteins including TNF-alpha and E-cadherin. Alternate splicing results in multiple transcript variants encoding different proteins that may undergo similar processing.

CellQuanti-Blue Cell Viability Assay Kits
CQBL-05K 5000
EUR 221
Description: Homogeneous assay for cell viability, proliferation, cytotoxcity, high-throµghput screening for anticancer agents. Fluorimetric method (530nm/590nm). Kit size: 5000 tests. Shelf life: 12 months. Shipping: ambient temp; storage: 4°C.

CellQuanti-Blue Cell Viability Assay Kits
CQBL-10K 10000
EUR 340
Description: Homogeneous assay for cell viability, proliferation, cytotoxcity, high-throµghput screening for anticancer agents. Fluorimetric method (530nm/590nm). Kit size: 10000 tests. Shelf life: 12 months. Shipping: ambient temp; storage: 4°C.

CellQuanti-MTT Cell Viability Assay Kits
CQMT-500 500
EUR 210
Description: Colorimetric (570nm) assay for cell viability, proliferation, cytotoxcity, HTS for anticancer agents. Kit size: 500 tests. Shelf life: 12 months. Shipping: ambient temp; storage: 4, -20°C.

MITOCHONDRIAL MEMBRANE POTENTIAL KIT Kits (OKSA11298)
OKSA11298 500 Tests
EUR 956
Description: Description of target: MITOCHONDRIAL MEMBRANE POTENTIAL KIT ;Species reactivity: Human;Application: FC, IF;Assay info: ;Sensitivity:

MITOCHONDRIAL MEMBRANE POTENTIAL KIT Kits (OKSA11300)
OKSA11300 500 Tests
EUR 956
Description: Description of target: MITOCHONDRIAL MEMBRANE POTENTIAL KIT ;Species reactivity: Human;Application: FC, IF;Assay info: ;Sensitivity:

Human ADAM10 shRNA Plasmid
20-abx950066
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADAM10 recombinant monoclonal antibody
A5298 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human ADAM10 for WB,ELISA

Mouse ADAM10 shRNA Plasmid
20-abx969028
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADAM10 Antibody, HRP conjugated
1-CSB-PA001273LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAM10. Recognizes ADAM10 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADAM10 Antibody, FITC conjugated
1-CSB-PA001273LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAM10. Recognizes ADAM10 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADAM10 Antibody, Biotin conjugated
1-CSB-PA001273LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAM10. Recognizes ADAM10 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ADAM10 Recombinant Protein (Human)
RP036424 100 ug Ask for price

ADAM10 Recombinant Protein (Mouse)
RP114161 100 ug Ask for price

Adam10 High Sensitivity ELISA Kit (Mouse) (OKCD01334)
OKCD01334 96 Wells
EUR 844
Description: Description of target: Cleaves the membrane-bound precursor of TNF-alpha to its mature soluble form. Responsible for the proteolytical release of soluble JAM3 from endothelial cells surface. Responsible for the proteolytic release of several other cell-surface proteins, including heparin-binding epidermal growth-like factor, ephrin-A2, CD44, CDH2 and for constitutive and regulated alpha-secretase cleavage of amyloid precursor protein (APP) at '687-Lys-|-Leu-688'. Contributes to the normal cleavage of the cellular prion protein. Involved in the cleavage of the adhesion molecule L1 at the cell surface and in released membrane vesicles, suggesting a vesicle-based protease activity. Controls also the proteolytic processing of Notch and mediates lateral inhibition during neurogenesis. Responsible for the FasL ectodomain shedding and for the generation of the remnant ADAM10-processed FasL (FasL APL) transmembrane form. Also cleaves the ectodomain of the integral membrane proteins CORIN and ITM2B. May regulate the EFNA5-EPHA3 signaling.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.7 pg/mL

ADAM10 Chemi-Luminescent ELISA Kit (Rat) (OKCD03691)
OKCD03691 96 Wells
EUR 1066
Description: Description of target: Cleaves the membrane-bound precursor of TNF-alpha to its mature soluble form. Responsible for the proteolytical release of soluble JAM3 from endothelial cells surface. Responsible for the proteolytic release of several other cell-surface proteins, including heparin-binding epidermal growth-like factor, ephrin-A2, CD44, CDH2 and for constitutive and regulated alpha-secretase cleavage of amyloid precursor protein (APP). Contributes to the normal cleavage of the cellular prion protein. Involved in the cleavage of the adhesion molecule L1 at the cell surface and in released membrane vesicles, suggesting a vesicle-based protease activity. Controls also the proteolytic processing of Notch and mediates lateral inhibition during neurogenesis. Responsible for the FasL ectodomain shedding and for the generation of the remnant ADAM10-processed FasL (FasL APL) transmembrane form. Also cleaves the ectodomain of the integral membrane proteins CORIN and ITM2B. May regulate the EFNA5-EPHA3 signaling.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

ADAM10 ELISA Kit (Human) : 96 Wells (OKEH02627)
OKEH02627 96 Wells
EUR 740
Description: Description of target: Members of the ADAM family are cell surface proteins with a unique structure possessing both potential adhesion and protease domains. This gene encodes and ADAM family member that cleaves many proteins including TNF-alpha and E-cadherin. Alternate splicing results in multiple transcript variants encoding different proteins that may undergo similar processing.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.045 ng/mL

ADAM10 Polyclonal Antibody, Biotin Conjugated
A58011 100 µg
EUR 570.55
Description: Ask the seller for details

ADAM10 Polyclonal Antibody, FITC Conjugated
A58012 100 µg
EUR 570.55
Description: The best epigenetics products

ADAM10 Polyclonal Antibody, HRP Conjugated
A58013 100 µg
EUR 570.55
Description: kits suitable for this type of research

ADAM10, Human Recombinant Protein, E.Coli
CG1002-002 2 ug
EUR 226

ADAM10, Human Recombinant Protein, E.Coli
CG1002-010 10 ug
EUR 300

Anti-ADAM10 Rabbit Monoclonal Antibody
M00566 100ug/vial
EUR 397
Description: Rabbit Monoclonal ADAM10 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

Adam10 ORF Vector (Mouse) (pORF)
ORF038055 1.0 ug DNA
EUR 506

ADAM10 ORF Vector (Human) (pORF)
ORF012142 1.0 ug DNA
EUR 354

Monkey ADAM Metallopeptidase Domain 10 (ADAM10) ELISA Kit
abx360194-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig ADAM Metallopeptidase Domain 10 (ADAM10) ELISA Kit
abx361975-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit ADAM Metallopeptidase Domain 10 (ADAM10) ELISA Kit
abx363169-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Cow ADAM Metallopeptidase Domain 10 (ADAM10) ELISA Kit
abx513940-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse ADAM Metallopeptidase Domain 10 (ADAM10) ELISA Kit
abx513942-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human ADAM Metallopeptidase Domain 10 (ADAM10) ELISA Kit
abx575998-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat ADAM Metallopeptidase Domain 10 (ADAM10) ELISA Kit
abx576388-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse ADAM Metallopeptidase Domain 10 (ADAM10) ELISA Kit
20-abx153594
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat ADAM Metallopeptidase Domain 10 (ADAM10) ELISA Kit
20-abx155141
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human ADAM Metallopeptidase Domain 10 (ADAM10) ELISA Kit
20-abx150542
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Chicken ADAM Metallopeptidase Domain 10 (ADAM10) ELISA Kit
abx356774-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse ADAM Metallopeptidase Domain 10 (ADAM10) ELISA Kit
20-abx258362
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human ADAM Metallopeptidase Domain 10 (ADAM10) ELISA Kit
abx250281-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mast/stem Cell Growth Factor Receptor Kit (Kits) Antibody
20-abx116620
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rabbit ANTI 14-3-3 ISOFORM PANEL Kits (OKSA11258)
OKSA11258 1 u
EUR 1236
Description: Description of target: RABBIT ANTI 14-3-3 ISOFORM PANEL;Species reactivity: Sheep;Application: ELISA, IHC-FFPE, WB;Assay info: ;Sensitivity:

Human Anti-Chikungunya virus (CHIKV) IgM capture ELISA kits, 96 tests, qualitative
910-705-CHM 1 Kit
EUR 834

ADAM10 sgRNA CRISPR Lentivector set (Human)
K0041801 3 x 1.0 ug
EUR 339

ADAM Metallopeptidase Domain 10 (ADAM10) Antibody
20-abx125489
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 10 (ADAM10) Antibody
abx147972-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 10 (ADAM10) Antibody
abx038455-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 10 (ADAM10) Antibody
20-abx323613
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 10 (ADAM10) Antibody
20-abx214006
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 10 (ADAM10) Antibody
abx412491-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

ADAM Metallopeptidase Domain 10 (ADAM10) Antibody
20-abx241176
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 10 (ADAM10) Antibody
20-abx301124
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adam10 sgRNA CRISPR Lentivector set (Mouse)
K4401401 3 x 1.0 ug
EUR 339

Human A Disintegrin And Metalloprotease 10(ADAM10)ELISA Kit
GA-E0785HM-48T 48T
EUR 289

Human A Disintegrin And Metalloprotease 10(ADAM10)ELISA Kit
GA-E0785HM-96T 96T
EUR 466

Human A Disintegrin And Metalloprotease 10,ADAM10 ELISA Kit
201-12-0769 96 tests
EUR 440
  • This A Disintegrin And Metalloprotease 10 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human A Disintegrin And Metalloprotease 10, ADAM10 ELISA Kit
CSB-E11172h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human A Disintegrin And Metalloprotease 10, ADAM10 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human A Disintegrin And Metalloprotease 10, ADAM10 ELISA Kit
1-CSB-E11172h
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human A Disintegrin And Metalloprotease 10, ADAM10 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human A Disintegrin And Metalloprotease 10,ADAM10 ELISA Kit
CN-03469H1 96T
EUR 452

Human A Disintegrin And Metalloprotease 10,ADAM10 ELISA Kit
CN-03469H2 48T
EUR 299

Human A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
SEA766Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloprotease 10 (ADAM10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloprotease 10 (ADAM10) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
SEA766Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloprotease 10 (ADAM10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloprotease 10 (ADAM10) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
SEA766Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloprotease 10 (ADAM10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloprotease 10 (ADAM10) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
SEA766Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloprotease 10 (ADAM10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloprotease 10 (ADAM10) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
4-SEA766Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as A Disintegrin And Metalloprotease 10 elisa. Alternative names of the recognized antigen: CD156-C
  • CD156c
  • MADM
  • Kuz
  • CDw156
  • Kuzbanian protein homolog
  • Mammalian disintegrin-metalloprotease
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human A Disintegrin And Metalloprotease 10 (ADAM10) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
SEA766Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse A Disintegrin And Metalloprotease 10 (ADAM10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse A Disintegrin And Metalloprotease 10 (ADAM10) in tissue homogenates, cell lysates and other biological fluids.

Mouse A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
SEA766Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse A Disintegrin And Metalloprotease 10 (ADAM10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse A Disintegrin And Metalloprotease 10 (ADAM10) in tissue homogenates, cell lysates and other biological fluids.

Mouse A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
SEA766Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse A Disintegrin And Metalloprotease 10 (ADAM10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse A Disintegrin And Metalloprotease 10 (ADAM10) in tissue homogenates, cell lysates and other biological fluids.

Mouse A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
SEA766Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse A Disintegrin And Metalloprotease 10 (ADAM10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse A Disintegrin And Metalloprotease 10 (ADAM10) in tissue homogenates, cell lysates and other biological fluids.

Mouse A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
4-SEA766Mu
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as A Disintegrin And Metalloprotease 10 elisa. Alternative names of the recognized antigen: CD156-C
  • CD156c
  • MADM
  • Kuz
  • CDw156
  • Kuzbanian protein homolog
  • Mammalian disintegrin-metalloprotease
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse A Disintegrin And Metalloprotease 10 (ADAM10) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
SEA766Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloprotease 10 (ADAM10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloprotease 10 (ADAM10) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
SEA766Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloprotease 10 (ADAM10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloprotease 10 (ADAM10) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
SEA766Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloprotease 10 (ADAM10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloprotease 10 (ADAM10) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
SEA766Ra-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloprotease 10 (ADAM10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloprotease 10 (ADAM10) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloprotease 10 (ADAM10) ELISA Kit
4-SEA766Ra
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as A Disintegrin And Metalloprotease 10 elisa. Alternative names of the recognized antigen: CD156-C
  • CD156c
  • MADM
  • Kuz
  • CDw156
  • Kuzbanian protein homolog
  • Mammalian disintegrin-metalloprotease
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat A Disintegrin And Metalloprotease 10 (ADAM10) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human A Disintegrin And Metalloprotease 10 ELISA Kit (ADAM10)
RK00811 96 Tests
EUR 521

Mouse A Disintegrin And Metalloprotease 10 ELISA Kit (ADAM10)
RK02570 96 Tests
EUR 521

Rat A Disintegrin And Metalloprotease 10 ELISA Kit (ADAM10)
RK03467 96 Tests
EUR 521

Human A Disintegrin And Metalloprotease 10(ADAM10)ELISA Kit
QY-E02774 96T
EUR 361

Rat A Disintegrin And Metalloprotease 10(ADAM10)ELISA kit
QY-E10418 96T
EUR 361
We present the event of biochemical assays in normal buffers for wild-type isocitrate dehydrogenase 1 (IDH1), diacylglycerol kinase zeta (DGKζ), and p300 histone acetyltransferase (P300) to show the suitability of this technique for a broad vary of high-throughput lead discovery assays. A proof-of-concept pilot display of ∼3k compounds can be proven for IDH1 and in comparison with a beforehand reported fluorescence-based assay. We had been capable of get hold of dependable knowledge at a velocity amenable for high-throughput screening of large-scale compound libraries.

Leave a Reply

Your email address will not be published. Required fields are marked *