PRC1 Rabbit Polyclonal Antibody
PRC1 Polyclonal Antibody |
ABP59992-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PRC1 protein at amino acid sequence of 460-520
- Applications tips:
|
Description: A polyclonal antibody for detection of PRC1 from Human. This PRC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRC1 protein at amino acid sequence of 460-520 |
PRC1 Polyclonal Antibody |
ABP59992-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PRC1 protein at amino acid sequence of 460-520
- Applications tips:
|
Description: A polyclonal antibody for detection of PRC1 from Human. This PRC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRC1 protein at amino acid sequence of 460-520 |
PRC1(Phospho-Thr481)Rabbit Polyclonal Antibody |
ES8619-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PRC1(Phospho-Thr481)Rabbit from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PRC1(Phospho-Thr481)Rabbit Polyclonal Antibody |
ES8619-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PRC1(Phospho-Thr481)Rabbit from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PRC1 Rabbit pAb |
A7029-100ul |
Abclonal |
100 ul |
EUR 308 |
PRC1 Rabbit pAb |
A7029-200ul |
Abclonal |
200 ul |
EUR 459 |
PRC1 Rabbit pAb |
A7029-20ul |
Abclonal |
20 ul |
EUR 183 |
PRC1 Rabbit pAb |
A7029-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal PRC1 Antibody (Internal) |
APR03046G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRC1 (Internal). This antibody is tested and proven to work in the following applications: |
Anti-PRC1 Rabbit Monoclonal Antibody |
M00160 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal PRC1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat. |
PRC1 Antibody |
36701-100ul |
SAB |
100ul |
EUR 252 |
PRC1 Antibody |
25481-100ul |
SAB |
100ul |
EUR 390 |
PRC1 antibody |
70R-19498 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PRC1 antibody |
PRC1 Antibody |
DF2955 |
Affbiotech |
200ul |
EUR 304 |
Description: PRC1 Antibody detects endogenous levels of total PRC1. |
PRC1 Antibody |
1-CSB-PA781917 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against PRC1. Recognizes PRC1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
PRC1 Antibody |
1-CSB-PA102179 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PRC1. Recognizes PRC1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
PRC1 Antibody |
1-CSB-PA018633GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PRC1. Recognizes PRC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
PRC1 (Phospho-Thr481) Polyclonal Antibody |
ABP59993-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PRC1 (Phospho-Thr481) Polyclonal Antibody protein at amino acid sequence of 481
- Applications tips:
|
Description: A polyclonal antibody for detection of PRC1 Phospho-Thr481) from Human. This PRC1 Phospho-Thr481) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRC1 (Phospho-Thr481) Polyclonal Antibody protein at amino acid sequence of 481 |
PRC1 (Phospho-Thr481) Polyclonal Antibody |
ABP59993-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PRC1 (Phospho-Thr481) Polyclonal Antibody protein at amino acid sequence of 481
- Applications tips:
|
Description: A polyclonal antibody for detection of PRC1 Phospho-Thr481) from Human. This PRC1 Phospho-Thr481) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRC1 (Phospho-Thr481) Polyclonal Antibody protein at amino acid sequence of 481 |
PRC1 (Phospho-Thr481) Polyclonal Antibody |
ABP59993-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PRC1 (Phospho-Thr481) Polyclonal Antibody protein at amino acid sequence of 481
- Applications tips:
|
Description: A polyclonal antibody for detection of PRC1 Phospho-Thr481) from Human. This PRC1 Phospho-Thr481) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRC1 (Phospho-Thr481) Polyclonal Antibody protein at amino acid sequence of 481 |
PRC1(Phospho-Thr481)Polyclonal Antibody |
12399-100ul |
SAB |
100ul |
EUR 252 |
PRC1(Phospho-Thr481)Polyclonal Antibody |
12399-50ul |
SAB |
50ul |
EUR 187 |
PRC1(Phospho-Thr481)Polyclonal Polyclonal Conjugated Antibody |
C12399 |
SAB |
100ul |
EUR 397 |
PRC1 (Phospho-Thr470) Polyclonal Conjugated Antibody |
C12694 |
SAB |
100ul |
EUR 397 |
PRC1 Conjugated Antibody |
C36701 |
SAB |
100ul |
EUR 397 |
anti- PRC1 antibody |
FNab06748 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: protein regulator of cytokinesis 1
- Uniprot ID: O43663
- Gene ID: 9055
- Research Area: Cell Division and Proliferation
|
Description: Antibody raised against PRC1 |
anti- PRC1 antibody |
FNab06749 |
FN Test |
100µg |
EUR 585 |
- Immunogen: protein regulator of cytokinesis 1
- Uniprot ID: O43663
- Gene ID: 9055
- Research Area: Cell Division and Proliferation
|
Description: Antibody raised against PRC1 |
PRC1 (pT470) Antibody |
abx217918-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
PRC1 (pT481) Antibody |
abx217919-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Anti-PRC1 Antibody |
PB9814 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-PRC1 antibody |
STJ98681 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to PRC1. |
Anti-PRC1 antibody |
STJ29109 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that is involved in cytokinesis. The protein is present at high levels during the S and G2/M phases of mitosis but its levels drop dramatically when the cell exits mitosis and enters the G1 phase. It is located in the nucleus during interphase, becomes associated with mitotic spindles in a highly dynamic manner during mitosis, and localizes to the cell mid-body during cytokinesis. This protein has been shown to be a substrate of several cyclin-dependent kinases (CDKs). It is necessary for polarizing parallel microtubules and concentrating the factors responsible for contractile ring assembly. Alternative splicing results in multiple transcript variants. |
PRC1 siRNA |
20-abx929646 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PRC1 siRNA |
20-abx929647 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-PRC1 (Thr470) Antibody |
AF8393 |
Affbiotech |
200ul |
EUR 376 |
Description: PRC1 (Phospho-Thr470) Antibody detects endogenous levels of PRC1 only when phosphorylated at Thr470. |
Phospho-PRC1 (Thr481) Antibody |
AF8394 |
Affbiotech |
200ul |
EUR 376 |
Description: PRC1 (Phospho-Thr481) Antibody detects endogenous levels of PRC1 only when phosphorylated at Thr481. |
PRC1 (Phospho-Thr470) Antibody |
12694-100ul |
SAB |
100ul |
EUR 252 |
PRC1 (Phospho-Thr470) Antibody |
12694-50ul |
SAB |
50ul |
EUR 187 |
Phospho-PRC1 (Thr481) Antibody |
1-CSB-PA399087 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against Phospho-PRC1 (Thr481). Recognizes Phospho-PRC1 (Thr481) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
PRC1 cloning plasmid |
CSB-CL018633HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1863
- Sequence: atgaggagaagtgaggtgctggcggaggagtccatagtatgtctgcagaaagccctaaatcaccttcgggaaatatgggagctaattgggattccagaggaccagcggttacaaagaactgaggtggtaaagaagcatatcaaggaactcctggatatgatgattgctgaagagg
- Show more
|
Description: A cloning plasmid for the PRC1 gene. |
PRC1 cloning plasmid |
CSB-CL018633HU2-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1731
- Sequence: atgaggagaagtgaggtgctggcggaggagtccatagtatgtctgcagaaagccctaaatcaccttcgggaaatatgggagctaattgggattccagaggaccagcggttacaaagaactgaggtggtaaagaagcatatcaaggaactcctggatatgatgattgctgaagagg
- Show more
|
Description: A cloning plasmid for the PRC1 gene. |
PRC1 Blocking Peptide |
DF2955-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-PRC1 antibody (Phospho-Thr481) |
STJ98682 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to PRC1 (Phospho-Thr481). |
Human PRC1 shRNA Plasmid |
20-abx955976 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PRC1 shRNA Plasmid |
20-abx982052 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PRC1 Recombinant Protein (Human) |
RP024493 |
ABM |
100 ug |
Ask for price |
PRC1 Recombinant Protein (Human) |
RP024496 |
ABM |
100 ug |
Ask for price |
PRC1 Recombinant Protein (Rat) |
RP221930 |
ABM |
100 ug |
Ask for price |
PRC1 Rabbit Polyclonal Antibody