PRC1 Rabbit Polyclonal Antibody

PRC1 Rabbit Polyclonal Antibody


PRC1 Polyclonal Antibody

ABP59992-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PRC1 protein at amino acid sequence of 460-520
  • Applications tips:
Description: A polyclonal antibody for detection of PRC1 from Human. This PRC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRC1 protein at amino acid sequence of 460-520

PRC1 Polyclonal Antibody

ABP59992-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PRC1 protein at amino acid sequence of 460-520
  • Applications tips:
Description: A polyclonal antibody for detection of PRC1 from Human. This PRC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRC1 protein at amino acid sequence of 460-520

PRC1(Phospho-Thr481)Rabbit Polyclonal Antibody

ES8619-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRC1(Phospho-Thr481)Rabbit from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PRC1(Phospho-Thr481)Rabbit Polyclonal Antibody

ES8619-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRC1(Phospho-Thr481)Rabbit from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PRC1 Rabbit pAb

A7029-100ul 100 ul
EUR 308

PRC1 Rabbit pAb

A7029-200ul 200 ul
EUR 459

PRC1 Rabbit pAb

A7029-20ul 20 ul
EUR 183

PRC1 Rabbit pAb

A7029-50ul 50 ul
EUR 223

Polyclonal PRC1 Antibody (Internal)

APR03046G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRC1 (Internal). This antibody is tested and proven to work in the following applications:

Anti-PRC1 Rabbit Monoclonal Antibody

M00160 100ug/vial
EUR 397
Description: Rabbit Monoclonal PRC1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

PRC1 Antibody

ABD2955 100 ug
EUR 438

PRC1 Antibody

36701-100ul 100ul
EUR 252

PRC1 Antibody

25481-100ul 100ul
EUR 390

PRC1 antibody

70R-19498 50 ul
EUR 435
Description: Rabbit polyclonal PRC1 antibody

PRC1 Antibody

DF2955 200ul
EUR 304
Description: PRC1 Antibody detects endogenous levels of total PRC1.

PRC1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against PRC1. Recognizes PRC1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

PRC1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRC1. Recognizes PRC1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

PRC1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PRC1. Recognizes PRC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PRC1 (Phospho-Thr481) Polyclonal Antibody

ABP59993-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PRC1 (Phospho-Thr481) Polyclonal Antibody protein at amino acid sequence of 481
  • Applications tips:
Description: A polyclonal antibody for detection of PRC1 Phospho-Thr481) from Human. This PRC1 Phospho-Thr481) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRC1 (Phospho-Thr481) Polyclonal Antibody protein at amino acid sequence of 481

PRC1 (Phospho-Thr481) Polyclonal Antibody

ABP59993-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PRC1 (Phospho-Thr481) Polyclonal Antibody protein at amino acid sequence of 481
  • Applications tips:
Description: A polyclonal antibody for detection of PRC1 Phospho-Thr481) from Human. This PRC1 Phospho-Thr481) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRC1 (Phospho-Thr481) Polyclonal Antibody protein at amino acid sequence of 481

PRC1 (Phospho-Thr481) Polyclonal Antibody

ABP59993-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PRC1 (Phospho-Thr481) Polyclonal Antibody protein at amino acid sequence of 481
  • Applications tips:
Description: A polyclonal antibody for detection of PRC1 Phospho-Thr481) from Human. This PRC1 Phospho-Thr481) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRC1 (Phospho-Thr481) Polyclonal Antibody protein at amino acid sequence of 481

PRC1(Phospho-Thr481)Polyclonal Antibody

12399-100ul 100ul
EUR 252

PRC1(Phospho-Thr481)Polyclonal Antibody

12399-50ul 50ul
EUR 187

PRC1(Phospho-Thr481)Polyclonal Polyclonal Conjugated Antibody

C12399 100ul
EUR 397

PRC1 (Phospho-Thr470) Polyclonal Conjugated Antibody

C12694 100ul
EUR 397

PRC1 Conjugated Antibody

C36701 100ul
EUR 397

anti- PRC1 antibody

FNab06748 100µg
EUR 505.25
  • Immunogen: protein regulator of cytokinesis 1
  • Uniprot ID: O43663
  • Gene ID: 9055
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against PRC1

anti- PRC1 antibody

FNab06749 100µg
EUR 585
  • Immunogen: protein regulator of cytokinesis 1
  • Uniprot ID: O43663
  • Gene ID: 9055
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against PRC1

PRC1 (pT470) Antibody

abx217918-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

PRC1 (pT481) Antibody

abx217919-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-PRC1 Antibody

PB9814 100ug/vial
EUR 294

Anti-PRC1 antibody

PAab06748 100 ug
EUR 355

Anti-PRC1 antibody

PAab06749 100 ug
EUR 412

Anti-PRC1 antibody

STJ98681 200 µl
EUR 197
Description: Rabbit polyclonal to PRC1.

Anti-PRC1 antibody

STJ29109 100 µl
EUR 277
Description: This gene encodes a protein that is involved in cytokinesis. The protein is present at high levels during the S and G2/M phases of mitosis but its levels drop dramatically when the cell exits mitosis and enters the G1 phase. It is located in the nucleus during interphase, becomes associated with mitotic spindles in a highly dynamic manner during mitosis, and localizes to the cell mid-body during cytokinesis. This protein has been shown to be a substrate of several cyclin-dependent kinases (CDKs). It is necessary for polarizing parallel microtubules and concentrating the factors responsible for contractile ring assembly. Alternative splicing results in multiple transcript variants.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT12260 2 ug
EUR 703

Phospho-PRC1 (Thr470) Antibody

AF8393 200ul
EUR 376
Description: PRC1 (Phospho-Thr470) Antibody detects endogenous levels of PRC1 only when phosphorylated at Thr470.

Phospho-PRC1 (Thr481) Antibody

AF8394 200ul
EUR 376
Description: PRC1 (Phospho-Thr481) Antibody detects endogenous levels of PRC1 only when phosphorylated at Thr481.

PRC1 (Phospho- Thr470) Antibody

ABF8393 100 ug
EUR 438

PRC1 (Phospho- Thr481) Antibody

ABF8394 100 ug
EUR 438

PRC1 (Phospho-Thr470) Antibody

12694-100ul 100ul
EUR 252

PRC1 (Phospho-Thr470) Antibody

12694-50ul 50ul
EUR 187

Phospho-PRC1 (Thr481) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against Phospho-PRC1 (Thr481). Recognizes Phospho-PRC1 (Thr481) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

PRC1 cloning plasmid

CSB-CL018633HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1863
  • Sequence: atgaggagaagtgaggtgctggcggaggagtccatagtatgtctgcagaaagccctaaatcaccttcgggaaatatgggagctaattgggattccagaggaccagcggttacaaagaactgaggtggtaaagaagcatatcaaggaactcctggatatgatgattgctgaagagg
  • Show more
Description: A cloning plasmid for the PRC1 gene.

PRC1 cloning plasmid

CSB-CL018633HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1731
  • Sequence: atgaggagaagtgaggtgctggcggaggagtccatagtatgtctgcagaaagccctaaatcaccttcgggaaatatgggagctaattgggattccagaggaccagcggttacaaagaactgaggtggtaaagaagcatatcaaggaactcctggatatgatgattgctgaagagg
  • Show more
Description: A cloning plasmid for the PRC1 gene.

PRC1 Blocking Peptide

DF2955-BP 1mg
EUR 195

Anti-PRC1 antibody (Phospho-Thr481)

STJ98682 200 µl
EUR 197
Description: Rabbit polyclonal to PRC1 (Phospho-Thr481).


EF002034 96 Tests
EUR 689

Human PRC1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PRC1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PRC1 Recombinant Protein (Human)

RP024493 100 ug Ask for price

PRC1 Recombinant Protein (Human)

RP024496 100 ug Ask for price

PRC1 Recombinant Protein (Rat)

RP221930 100 ug Ask for price

pCS2- Myc- Prc1- m

PVT10437 2 ug
EUR 370


PRC1 Rabbit Polyclonal Antibody