PNKP Rabbit Polyclonal Antibody
PNKP Polyclonal Antibody |
ABP59961-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PNKP protein at amino acid sequence of 50-130
- Applications tips:
|
Description: A polyclonal antibody for detection of PNKP from Human. This PNKP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PNKP protein at amino acid sequence of 50-130 |
PNKP Polyclonal Antibody |
ABP59961-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PNKP protein at amino acid sequence of 50-130
- Applications tips:
|
Description: A polyclonal antibody for detection of PNKP from Human. This PNKP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PNKP protein at amino acid sequence of 50-130 |
PNKP Rabbit pAb |
A6693-100ul |
Abclonal |
100 ul |
EUR 308 |
PNKP Rabbit pAb |
A6693-200ul |
Abclonal |
200 ul |
EUR 459 |
PNKP Rabbit pAb |
A6693-20ul |
Abclonal |
20 ul |
EUR 183 |
PNKP Rabbit pAb |
A6693-50ul |
Abclonal |
50 ul |
EUR 223 |
PNKP antibody |
70R-4477 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PNKP antibody raised against the N terminal of PNKP |
PNKP antibody |
70R-4478 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PNKP antibody raised against the middle region of PNKP |
PNKP antibody |
39107-100ul |
SAB |
100ul |
EUR 252 |
PNKP Antibody |
39908-100ul |
SAB |
100ul |
EUR 390 |
PNKP Antibody |
DF10318 |
Affbiotech |
200ul |
EUR 304 |
Description: PNKP Antibody detects endogenous levels of PNKP. |
PNKP (Phospho-Ser114) Polyclonal Conjugated Antibody |
C12775 |
SAB |
100ul |
EUR 397 |
PNKP Conjugated Antibody |
C39107 |
SAB |
100ul |
EUR 397 |
anti- PNKP antibody |
FNab06583 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: polynucleotide kinase 3'-phosphatase
- Uniprot ID: Q96T60
- Gene ID: 11284
- Research Area: Metabolism
|
Description: Antibody raised against PNKP |
PNKP (pS114) Antibody |
abx217835-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Anti-PNKP antibody |
STJ28776 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This locus represents a gene involved in DNA repair. In response to ionizing radiation or oxidative damage, the protein encoded by this locus catalyzes 5' phosphorylation and 3' dephosphorylation of nucleic acids. Mutations at this locus have been associated with microcephaly, seizures, and developmental delay. |
Anti-PNKP antibody |
STJ190167 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PNKP |
PNKP siRNA |
20-abx929062 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PNKP |
LF-PA10022 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PNKP |
Phospho-PNKP (Ser114) Antibody |
AF8503 |
Affbiotech |
200ul |
EUR 376 |
Description: PNKP (Phospho-Ser114) Antibody detects endogenous levels of PNKP only when phosphorylated at Ser114. |
PNKP (Phospho-Ser114) Antibody |
12775-100ul |
SAB |
100ul |
EUR 252 |
PNKP (Phospho-Ser114) Antibody |
12775-50ul |
SAB |
50ul |
EUR 187 |
PNKP Blocking Peptide |
33R-6026 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PNKP antibody, catalog no. 70R-4477 |
PNKP Blocking Peptide |
33R-1356 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HSPCB antibody, catalog no. 20R-1314 |
PNKP cloning plasmid |
CSB-CL857031HU1-10ug |
Cusabio |
10ug |
EUR 548 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1566
- Sequence: atgggcgaggtggaggccccgggccgcttgtggctcgagagcccccctgggggagcgccccccatcttcctgccctcggacgggcaagccctggtcctgggcaggggacccctgacccaggttacggaccggaagtgctccagaactcaagtggagctggtcgcagatcctgaga
- Show more
|
Description: A cloning plasmid for the PNKP gene. |
PNKP cloning plasmid |
CSB-CL857031HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1449
- Sequence: atgcaaatcctgactccacccctccaatcctcagtggagctggtcgcagatcctgagacccggacagtggcagtgaaacagctgggagttaacccctcaactaccgggacccaggagttgaagccggggttggagggctctctgggggtgggggacacactgtatttggtcaatg
- Show more
|
Description: A cloning plasmid for the PNKP gene. |
PNKP Blocking Peptide |
DF10318-BP |
Affbiotech |
1mg |
EUR 195 |
Human PNKP shRNA Plasmid |
20-abx957739 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PNKP Recombinant Protein (Human) |
RP023932 |
ABM |
100 ug |
Ask for price |
PNKP Recombinant Protein (Human) |
RP023935 |
ABM |
100 ug |
Ask for price |
PNKP Recombinant Protein (Rat) |
RP221165 |
ABM |
100 ug |
Ask for price |
PNKP Recombinant Protein (Mouse) |
RP163121 |
ABM |
100 ug |
Ask for price |
Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody |
20-abx142149 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody |
abx036773-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody |
20-abx005133 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody |
abx027808-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody |
abx027808-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody |
abx430284-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody |
abx236583-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Aprataxin And PNKP Like Factor (APLF) Antibody |
20-abx111036 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Aprataxin And PNKP Like Factor (APLF) Antibody |
20-abx012964 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Aprataxin And PNKP Like Factor (APLF) Antibody |
20-abx325901 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Aprataxin And PNKP Like Factor (APLF) Antibody |
20-abx339818 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Aprataxin And PNKP Like Factor (APLF) Antibody |
abx331532-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Aprataxin And PNKP Like Factor (APLF) Antibody |
abx230484-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Aprataxin And PNKP Like Factor (APLF) Antibody |
20-abx210495 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-PNKP (Ser114) Blocking Peptide |
AF8503-BP |
Affbiotech |
1mg |
EUR 195 |
PNKP ORF Vector (Human) (pORF) |
ORF007978 |
ABM |
1.0 ug DNA |
EUR 95 |
PNKP ORF Vector (Human) (pORF) |
ORF007979 |
ABM |
1.0 ug DNA |
EUR 95 |
Pnkp ORF Vector (Rat) (pORF) |
ORF073723 |
ABM |
1.0 ug DNA |
EUR 506 |
Pnkp ORF Vector (Mouse) (pORF) |
ORF054375 |
ABM |
1.0 ug DNA |
EUR 506 |
PNKP sgRNA CRISPR Lentivector set (Human) |
K1676001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Bifunctional polynucleotide phosphatase/kinase (PNKP) |
1-CSB-EP857031HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 73.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Bifunctional polynucleotide phosphatase/kinase(PNKP) expressed in E.coli |
Pnkp sgRNA CRISPR Lentivector set (Rat) |
K7470801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pnkp sgRNA CRISPR Lentivector set (Mouse) |
K4958201 |
ABM |
3 x 1.0 ug |
EUR 339 |
PNKP sgRNA CRISPR Lentivector (Human) (Target 1) |
K1676002 |
ABM |
1.0 ug DNA |
EUR 154 |
PNKP sgRNA CRISPR Lentivector (Human) (Target 2) |
K1676003 |
ABM |
1.0 ug DNA |
EUR 154 |
PNKP sgRNA CRISPR Lentivector (Human) (Target 3) |
K1676004 |
ABM |
1.0 ug DNA |
EUR 154 |
Pnkp sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7470802 |
ABM |
1.0 ug DNA |
EUR 154 |
Pnkp sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7470803 |
ABM |
1.0 ug DNA |
EUR 154 |
Pnkp sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7470804 |
ABM |
1.0 ug DNA |
EUR 154 |
Pnkp sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4958202 |
ABM |
1.0 ug DNA |
EUR 154 |
Pnkp sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4958203 |
ABM |
1.0 ug DNA |
EUR 154 |
Pnkp sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4958204 |
ABM |
1.0 ug DNA |
EUR 154 |
PNKP Protein Vector (Human) (pPB-C-His) |
PV031909 |
ABM |
500 ng |
EUR 329 |
PNKP Protein Vector (Human) (pPB-N-His) |
PV031910 |
ABM |
500 ng |
EUR 329 |
PNKP Protein Vector (Human) (pPM-C-HA) |
PV031911 |
ABM |
500 ng |
EUR 329 |
PNKP Protein Vector (Human) (pPM-C-His) |
PV031912 |
ABM |
500 ng |
EUR 329 |
PNKP Protein Vector (Human) (pPB-C-His) |
PV031913 |
ABM |
500 ng |
EUR 329 |
PNKP Protein Vector (Human) (pPB-N-His) |
PV031914 |
ABM |
500 ng |
EUR 329 |
PNKP Protein Vector (Human) (pPM-C-HA) |
PV031915 |
ABM |
500 ng |
EUR 329 |
PNKP Protein Vector (Human) (pPM-C-His) |
PV031916 |
ABM |
500 ng |
EUR 329 |
PNKP Protein Vector (Mouse) (pPB-C-His) |
PV217498 |
ABM |
500 ng |
EUR 603 |
PNKP Protein Vector (Mouse) (pPB-N-His) |
PV217499 |
ABM |
500 ng |
EUR 603 |
PNKP Protein Vector (Mouse) (pPM-C-HA) |
PV217500 |
ABM |
500 ng |
EUR 603 |
PNKP Protein Vector (Mouse) (pPM-C-His) |
PV217501 |
ABM |
500 ng |
EUR 603 |
PNKP Protein Vector (Rat) (pPB-C-His) |
PV294890 |
ABM |
500 ng |
EUR 603 |
PNKP Protein Vector (Rat) (pPB-N-His) |
PV294891 |
ABM |
500 ng |
EUR 603 |
PNKP Protein Vector (Rat) (pPM-C-HA) |
PV294892 |
ABM |
500 ng |
EUR 603 |
PNKP Protein Vector (Rat) (pPM-C-His) |
PV294893 |
ABM |
500 ng |
EUR 603 |
PNKP 3'UTR Luciferase Stable Cell Line |
TU018347 |
ABM |
1.0 ml |
EUR 1394 |
PNKP 3'UTR GFP Stable Cell Line |
TU068347 |
ABM |
1.0 ml |
EUR 1394 |
Aprataxin And PNKP Like Factor Phospho-Ser116 (APLF pS116) Antibody |
20-abx325264 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Pnkp ELISA Kit| Mouse Bifunctional polynucleotide phosphatase/k |
EF015921 |
Lifescience Market |
96 Tests |
EUR 689 |
Human Bifunctional polynucleotide phosphatase/kinase (PNKP) ELISA Kit |
abx382322-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
PNKP Rabbit Polyclonal Antibody