PNKP Rabbit Polyclonal Antibody

PNKP Rabbit Polyclonal Antibody


PNKP Polyclonal Antibody

ABP59961-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PNKP protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of PNKP from Human. This PNKP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PNKP protein at amino acid sequence of 50-130

PNKP Polyclonal Antibody

ABP59961-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PNKP protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of PNKP from Human. This PNKP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PNKP protein at amino acid sequence of 50-130

PNKP Rabbit pAb

A6693-100ul 100 ul
EUR 308

PNKP Rabbit pAb

A6693-200ul 200 ul
EUR 459

PNKP Rabbit pAb

A6693-20ul 20 ul
EUR 183

PNKP Rabbit pAb

A6693-50ul 50 ul
EUR 223

PNKP antibody

70R-4477 50 ug
EUR 467
Description: Rabbit polyclonal PNKP antibody raised against the N terminal of PNKP

PNKP antibody

70R-4478 50 ug
EUR 467
Description: Rabbit polyclonal PNKP antibody raised against the middle region of PNKP

PNKP antibody

39107-100ul 100ul
EUR 252

PNKP Antibody

39908-100ul 100ul
EUR 390

PNKP Antibody

DF10318 200ul
EUR 304
Description: PNKP Antibody detects endogenous levels of PNKP.

PNKP (Phospho-Ser114) Polyclonal Conjugated Antibody

C12775 100ul
EUR 397

PNKP Conjugated Antibody

C39107 100ul
EUR 397

anti- PNKP antibody

FNab06583 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: polynucleotide kinase 3'-phosphatase
  • Uniprot ID: Q96T60
  • Gene ID: 11284
  • Research Area: Metabolism
Description: Antibody raised against PNKP

PNKP (pS114) Antibody

abx217835-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-PNKP antibody

PAab06583 100 ug
EUR 355

Anti-PNKP antibody

STJ28776 100 µl
EUR 277
Description: This locus represents a gene involved in DNA repair. In response to ionizing radiation or oxidative damage, the protein encoded by this locus catalyzes 5' phosphorylation and 3' dephosphorylation of nucleic acids. Mutations at this locus have been associated with microcephaly, seizures, and developmental delay.

Anti-PNKP antibody

STJ190167 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PNKP


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


LF-PA10022 50 ul
EUR 334
Description: Mouse polyclonal to PNKP

Phospho-PNKP (Ser114) Antibody

AF8503 200ul
EUR 376
Description: PNKP (Phospho-Ser114) Antibody detects endogenous levels of PNKP only when phosphorylated at Ser114.

PNKP (Phospho- Ser114) Antibody

ABF8503 100 ug
EUR 438

PNKP (Phospho-Ser114) Antibody

12775-100ul 100ul
EUR 252

PNKP (Phospho-Ser114) Antibody

12775-50ul 50ul
EUR 187

Anti-PNKP / PNK antibody

STJ70208 100 µg
EUR 359

PNKP Blocking Peptide

33R-6026 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PNKP antibody, catalog no. 70R-4477

PNKP Blocking Peptide

33R-1356 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HSPCB antibody, catalog no. 20R-1314

PNKP cloning plasmid

CSB-CL857031HU1-10ug 10ug
EUR 548
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1566
  • Sequence: atgggcgaggtggaggccccgggccgcttgtggctcgagagcccccctgggggagcgccccccatcttcctgccctcggacgggcaagccctggtcctgggcaggggacccctgacccaggttacggaccggaagtgctccagaactcaagtggagctggtcgcagatcctgaga
  • Show more
Description: A cloning plasmid for the PNKP gene.

PNKP cloning plasmid

CSB-CL857031HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1449
  • Sequence: atgcaaatcctgactccacccctccaatcctcagtggagctggtcgcagatcctgagacccggacagtggcagtgaaacagctgggagttaacccctcaactaccgggacccaggagttgaagccggggttggagggctctctgggggtgggggacacactgtatttggtcaatg
  • Show more
Description: A cloning plasmid for the PNKP gene.

PNKP Blocking Peptide

DF10318-BP 1mg
EUR 195


EF001895 96 Tests
EUR 689


ELI-37326h 96 Tests
EUR 824

Mouse Pnkp ELISA KIT

ELI-45543m 96 Tests
EUR 865

Human PNKP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PNKP Recombinant Protein (Human)

RP023932 100 ug Ask for price

PNKP Recombinant Protein (Human)

RP023935 100 ug Ask for price

PNKP Recombinant Protein (Rat)

RP221165 100 ug Ask for price

PNKP Recombinant Protein (Mouse)

RP163121 100 ug Ask for price

Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody

abx036773-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody

abx027808-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody

abx027808-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody

abx430284-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody

abx236583-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody

abx331532-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody

abx230484-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phospho-PNKP (Ser114) Blocking Peptide

AF8503-BP 1mg
EUR 195

PNKP ORF Vector (Human) (pORF)

ORF007978 1.0 ug DNA
EUR 95

PNKP ORF Vector (Human) (pORF)

ORF007979 1.0 ug DNA
EUR 95

Pnkp ORF Vector (Rat) (pORF)

ORF073723 1.0 ug DNA
EUR 506

Pnkp ORF Vector (Mouse) (pORF)

ORF054375 1.0 ug DNA
EUR 506

PNKP sgRNA CRISPR Lentivector set (Human)

K1676001 3 x 1.0 ug
EUR 339

Human Bifunctional polynucleotide phosphatase/kinase (PNKP)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 73.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Bifunctional polynucleotide phosphatase/kinase(PNKP) expressed in E.coli

Pnkp sgRNA CRISPR Lentivector set (Rat)

K7470801 3 x 1.0 ug
EUR 339

Pnkp sgRNA CRISPR Lentivector set (Mouse)

K4958201 3 x 1.0 ug
EUR 339

PNKP sgRNA CRISPR Lentivector (Human) (Target 1)

K1676002 1.0 ug DNA
EUR 154

PNKP sgRNA CRISPR Lentivector (Human) (Target 2)

K1676003 1.0 ug DNA
EUR 154

PNKP sgRNA CRISPR Lentivector (Human) (Target 3)

K1676004 1.0 ug DNA
EUR 154

Pnkp sgRNA CRISPR Lentivector (Rat) (Target 1)

K7470802 1.0 ug DNA
EUR 154

Pnkp sgRNA CRISPR Lentivector (Rat) (Target 2)

K7470803 1.0 ug DNA
EUR 154

Pnkp sgRNA CRISPR Lentivector (Rat) (Target 3)

K7470804 1.0 ug DNA
EUR 154

Pnkp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4958202 1.0 ug DNA
EUR 154

Pnkp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4958203 1.0 ug DNA
EUR 154

Pnkp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4958204 1.0 ug DNA
EUR 154

PNKP Protein Vector (Human) (pPB-C-His)

PV031909 500 ng
EUR 329

PNKP Protein Vector (Human) (pPB-N-His)

PV031910 500 ng
EUR 329

PNKP Protein Vector (Human) (pPM-C-HA)

PV031911 500 ng
EUR 329

PNKP Protein Vector (Human) (pPM-C-His)

PV031912 500 ng
EUR 329

PNKP Protein Vector (Human) (pPB-C-His)

PV031913 500 ng
EUR 329

PNKP Protein Vector (Human) (pPB-N-His)

PV031914 500 ng
EUR 329

PNKP Protein Vector (Human) (pPM-C-HA)

PV031915 500 ng
EUR 329

PNKP Protein Vector (Human) (pPM-C-His)

PV031916 500 ng
EUR 329

PNKP Protein Vector (Mouse) (pPB-C-His)

PV217498 500 ng
EUR 603

PNKP Protein Vector (Mouse) (pPB-N-His)

PV217499 500 ng
EUR 603

PNKP Protein Vector (Mouse) (pPM-C-HA)

PV217500 500 ng
EUR 603

PNKP Protein Vector (Mouse) (pPM-C-His)

PV217501 500 ng
EUR 603

PNKP Protein Vector (Rat) (pPB-C-His)

PV294890 500 ng
EUR 603

PNKP Protein Vector (Rat) (pPB-N-His)

PV294891 500 ng
EUR 603

PNKP Protein Vector (Rat) (pPM-C-HA)

PV294892 500 ng
EUR 603

PNKP Protein Vector (Rat) (pPM-C-His)

PV294893 500 ng
EUR 603

PNKP 3'UTR Luciferase Stable Cell Line

TU018347 1.0 ml
EUR 1394

PNKP 3'UTR GFP Stable Cell Line

TU068347 1.0 ml
EUR 1394

Aprataxin And PNKP Like Factor Phospho-Ser116 (APLF pS116) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pnkp ELISA Kit| Mouse Bifunctional polynucleotide phosphatase/k

EF015921 96 Tests
EUR 689

Human Bifunctional polynucleotide phosphatase/kinase (PNKP) ELISA Kit

abx382322-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.


PNKP Rabbit Polyclonal Antibody