PLD4 Rabbit Polyclonal Antibody
PLD4 Polyclonal Antibody |
ABP59938-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PLD4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PLD4 from Human, Mouse, Rat. This PLD4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLD4 protein |
PLD4 Polyclonal Antibody |
ABP59938-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PLD4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PLD4 from Human, Mouse, Rat. This PLD4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLD4 protein |
PLD4 Polyclonal Antibody |
ABP59938-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PLD4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PLD4 from Human, Mouse, Rat. This PLD4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLD4 protein |
PLD4 Polyclonal Antibody |
ES8933-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PLD4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PLD4 Polyclonal Antibody |
ES8933-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PLD4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PLD4 Rabbit pAb |
A15207-100ul |
Abclonal |
100 ul |
EUR 308 |
PLD4 Rabbit pAb |
A15207-200ul |
Abclonal |
200 ul |
EUR 459 |
PLD4 Rabbit pAb |
A15207-20ul |
Abclonal |
20 ul |
EUR 183 |
PLD4 Rabbit pAb |
A15207-50ul |
Abclonal |
50 ul |
EUR 223 |
PC-PLD4 Polyclonal Antibody |
ABP53702-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human PC-PLD4 at AA rangle: 430-510
- Applications tips:
|
Description: A polyclonal antibody for detection of PC-PLD4 from Human, Mouse, Rat. This PC-PLD4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PC-PLD4 at AA rangle: 430-510 |
PC-PLD4 Polyclonal Antibody |
ABP53702-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human PC-PLD4 at AA rangle: 430-510
- Applications tips:
|
Description: A polyclonal antibody for detection of PC-PLD4 from Human, Mouse, Rat. This PC-PLD4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PC-PLD4 at AA rangle: 430-510 |
PC-PLD4 Polyclonal Antibody |
ABP53702-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human PC-PLD4 at AA rangle: 430-510
- Applications tips:
|
Description: A polyclonal antibody for detection of PC-PLD4 from Human, Mouse, Rat. This PC-PLD4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PC-PLD4 at AA rangle: 430-510 |
PC-PLD4 Polyclonal Antibody |
ES4701-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PC-PLD4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PC-PLD4 Polyclonal Antibody |
ES4701-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PC-PLD4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PLD4 Antibody |
34905-100ul |
SAB |
100ul |
EUR 252 |
PLD4 Antibody |
34905-50ul |
SAB |
50ul |
EUR 187 |
PLD4 Antibody |
1-CSB-PA839298LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLD4. Recognizes PLD4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200 |
PLD4 Antibody |
DF4294 |
Affbiotech |
200ul |
EUR 304 |
Description: PLD4 Antibody detects endogenous levels of total PLD4. |
PLD4 Antibody |
CSB-PA219574- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against PLD4. Recognizes PLD4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
PLD4 Antibody |
CSB-PA219574-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against PLD4. Recognizes PLD4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
PLD4 Antibody |
1-CSB-PA006980 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against PLD4. Recognizes PLD4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000 |
PLD4 antibody |
70R-35616 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Rabbit polyclonal PLD4 antibody |
PLD4 Polyclonal Antibody, HRP Conjugated |
A51090 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
PLD4 Polyclonal Antibody, FITC Conjugated |
A51091 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
PLD4 Polyclonal Antibody, Biotin Conjugated |
A51092 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Anti-PLD4 Antibody |
A13908 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal PLD4 Antibody. Validated in WB and tested in Human, Mouse, Rat. |
PLD4 Conjugated Antibody |
C34905 |
SAB |
100ul |
EUR 397 |
Anti-PLD4 antibody |
STJ99651 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to PLD4. |
PLD4 siRNA |
20-abx928872 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLD4 siRNA |
20-abx928873 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PLD4 |
YF-PA22051 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to PLD4 |
Polyclonal PLD4 / Phospholipase D4 Antibody (aa457-506) |
AMR09377G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLD4 / Phospholipase D4 (aa457-506). This antibody is tested and proven to work in the following applications: |
PLD4 Antibody, HRP conjugated |
1-CSB-PA839298LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLD4. Recognizes PLD4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PLD4 Antibody, FITC conjugated |
1-CSB-PA839298LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLD4. Recognizes PLD4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PLD4 Antibody, Biotin conjugated |
1-CSB-PA839298LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLD4. Recognizes PLD4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-PC-PLD4 antibody |
STJ94987 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to PC-PLD4. |
PLD4 Blocking Peptide |
DF4294-BP |
Affbiotech |
1mg |
EUR 195 |
PLD4 cloning plasmid |
CSB-CL839298HU-10ug |
Cusabio |
10ug |
EUR 521 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1470
- Sequence: atgccgccccgccgcccgtgggacagagaggctggcacgttgcaggtcctgggagcgctggctgtgctgtggctgggctccgtggctcttatctgcctcctgtggcaagtgccccgtcctcccacctggggccaggtgcagcccaaggacgtgcccaggtcctgggagcatggct
- Show more
|
Description: A cloning plasmid for the PLD4 gene. |
Human Phospholipase D4 (PLD4) |
1-CSB-EP839298HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 66 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Phospholipase D4(PLD4),partial expressed in E.coli |
Human PLD4 shRNA Plasmid |
20-abx964699 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PLD4 shRNA Plasmid |
20-abx979658 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PLD4 Recombinant Protein (Human) |
RP023746 |
ABM |
100 ug |
Ask for price |
PLD4 Recombinant Protein (Mouse) |
RP162707 |
ABM |
100 ug |
Ask for price |
PLD4 Recombinant Protein (Rat) |
RP220880 |
ABM |
100 ug |
Ask for price |
Phospholipase D Family Member 4 (PLD4) Antibody |
20-abx014716 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Phospholipase D Family Member 4 (PLD4) Antibody |
abx036464-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Phospholipase D Family Member 4 (PLD4) Antibody |
abx029677-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Phospholipase D Family Member 4 (PLD4) Antibody |
abx029677-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Phospholipase D Family Member 4 (PLD4) Antibody |
20-abx327976 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospholipase D Family Member 4 (PLD4) Antibody |
abx332704-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Phospholipase D Family Member 4 (PLD4) Antibody |
20-abx302921 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Pld4 ORF Vector (Rat) (pORF) |
ORF073628 |
ABM |
1.0 ug DNA |
EUR 506 |
PLD4 ORF Vector (Human) (pORF) |
ORF007916 |
ABM |
1.0 ug DNA |
EUR 95 |
Pld4 ORF Vector (Mouse) (pORF) |
ORF054237 |
ABM |
1.0 ug DNA |
EUR 506 |
Phospholipase D Family Member 4 (PLD4) Antibody (HRP) |
20-abx309341 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phospholipase D Family Member 4 (PLD4) Antibody (FITC) |
20-abx309342 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phospholipase D Family Member 4 (PLD4) Antibody (Biotin) |
20-abx309343 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Phospholipase D4 (PLD4)ELISA Kit |
201-12-2644 |
SunredBio |
96 tests |
EUR 440 |
- This Phospholipase D4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Pld4 sgRNA CRISPR Lentivector set (Rat) |
K6349401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pld4 sgRNA CRISPR Lentivector set (Mouse) |
K3734001 |
ABM |
3 x 1.0 ug |
EUR 339 |
PLD4 sgRNA CRISPR Lentivector set (Human) |
K1664501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pld4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6349402 |
ABM |
1.0 ug DNA |
EUR 154 |
Pld4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6349403 |
ABM |
1.0 ug DNA |
EUR 154 |
Pld4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6349404 |
ABM |
1.0 ug DNA |
EUR 154 |
Pld4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3734002 |
ABM |
1.0 ug DNA |
EUR 154 |
Pld4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3734003 |
ABM |
1.0 ug DNA |
EUR 154 |
Pld4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3734004 |
ABM |
1.0 ug DNA |
EUR 154 |
PLD4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1664502 |
ABM |
1.0 ug DNA |
EUR 154 |
PLD4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1664503 |
ABM |
1.0 ug DNA |
EUR 154 |
PLD4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1664504 |
ABM |
1.0 ug DNA |
EUR 154 |
PLD4 Protein Vector (Rat) (pPB-C-His) |
PV294510 |
ABM |
500 ng |
EUR 603 |
PLD4 Protein Vector (Rat) (pPB-N-His) |
PV294511 |
ABM |
500 ng |
EUR 603 |
PLD4 Protein Vector (Rat) (pPM-C-HA) |
PV294512 |
ABM |
500 ng |
EUR 603 |
PLD4 Protein Vector (Rat) (pPM-C-His) |
PV294513 |
ABM |
500 ng |
EUR 603 |
PLD4 Protein Vector (Human) (pPB-C-His) |
PV031661 |
ABM |
500 ng |
EUR 329 |
PLD4 Protein Vector (Human) (pPB-N-His) |
PV031662 |
ABM |
500 ng |
EUR 329 |
PLD4 Protein Vector (Human) (pPM-C-HA) |
PV031663 |
ABM |
500 ng |
EUR 329 |
PLD4 Protein Vector (Human) (pPM-C-His) |
PV031664 |
ABM |
500 ng |
EUR 329 |
PLD4 Protein Vector (Mouse) (pPB-C-His) |
PV216946 |
ABM |
500 ng |
EUR 603 |
PLD4 Protein Vector (Mouse) (pPB-N-His) |
PV216947 |
ABM |
500 ng |
EUR 603 |
PLD4 Protein Vector (Mouse) (pPM-C-HA) |
PV216948 |
ABM |
500 ng |
EUR 603 |
PLD4 Protein Vector (Mouse) (pPM-C-His) |
PV216949 |
ABM |
500 ng |
EUR 603 |
Pld4 3'UTR Luciferase Stable Cell Line |
TU116517 |
ABM |
1.0 ml |
Ask for price |
Pld4 3'UTR GFP Stable Cell Line |
TU166517 |
ABM |
1.0 ml |
Ask for price |
Pld4 3'UTR Luciferase Stable Cell Line |
TU216377 |
ABM |
1.0 ml |
Ask for price |
Pld4 3'UTR GFP Stable Cell Line |
TU266377 |
ABM |
1.0 ml |
Ask for price |
PLD4 3'UTR GFP Stable Cell Line |
TU068226 |
ABM |
1.0 ml |
EUR 1394 |
PLD4 3'UTR Luciferase Stable Cell Line |
TU018226 |
ABM |
1.0 ml |
EUR 1394 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
PLD4 Rabbit Polyclonal Antibody