PEX14 Rabbit Polyclonal Antibody

PEX14 Rabbit Polyclonal Antibody


PEX14 Rabbit pAb

A7336-100ul 100 ul
EUR 308

PEX14 Rabbit pAb

A7336-200ul 200 ul
EUR 459

PEX14 Rabbit pAb

A7336-20ul 20 ul
EUR 183

PEX14 Rabbit pAb

A7336-50ul 50 ul
EUR 223

Polyclonal PEX14 Antibody (Center)

AMM07100G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PEX14 (Center). This antibody is tested and proven to work in the following applications:

PEX14 antibody

70R-19219 50 ul
EUR 435
Description: Rabbit polyclonal PEX14 antibody

PEX14 Antibody

34892-100ul 100ul
EUR 252

PEX14 Antibody

34892-50ul 50ul
EUR 187

PEX14 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PEX14 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Arabidopsis thaliana. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

PEX14 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

PEX14 Antibody

CSB-PA775947-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

PEX14 Antibody

DF4284 200ul
EUR 304
Description: PEX14 Antibody detects endogenous levels of total PEX14.

PEX14 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PEX14 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PEX14 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IF

PEX14 antibody

70R-50193 100 ul
EUR 244
Description: Purified Polyclonal PEX14 antibody

PEX14 Antibody

ABD4284 100 ug
EUR 438

Pex14/ Rat Pex14 ELISA Kit

ELI-20908r 96 Tests
EUR 886

Anti-PEX14 Antibody

A03327 100ul
EUR 397
Description: Rabbit Polyclonal PEX14 Antibody. Validated in IHC, WB and tested in Human, Mouse.

PEX14 Conjugated Antibody

C34892 100ul
EUR 397

anti- PEX14 antibody

FNab06327 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: peroxisomal biogenesis factor 14
  • Uniprot ID: O75381
  • Gene ID: 5195
  • Research Area: Signal Transduction
Description: Antibody raised against PEX14

Anti-PEX14 antibody

PAab06327 100 ug
EUR 355

Anti-PEX14 antibody

STJ29475 100 µl
EUR 277
Description: This gene encodes an essential component of the peroxisomal import machinery. The protein is integrated into peroxisome membranes with its C-terminus exposed to the cytosol, and interacts with the cytosolic receptor for proteins containing a PTS1 peroxisomal targeting signal. The protein also functions as a transcriptional corepressor and interacts with a histone deacetylase. A mutation in this gene results in one form of Zellweger syndrome.

Anti-PEX14 antibody

STJ99650 200 µl
EUR 197
Description: Rabbit polyclonal to PEX14.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13722 50 ug
EUR 363
Description: Mouse polyclonal to PEX14

PEX14 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Arabidopsis thaliana. This antibody is HRP conjugated. Tested in the following application: ELISA

PEX14 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Arabidopsis thaliana. This antibody is FITC conjugated. Tested in the following application: ELISA

PEX14 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Arabidopsis thaliana. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Peroxisomal membrane protein PEX14, PEX14 ELISA KIT

ELI-35662h 96 Tests
EUR 824

Mouse Peroxisomal membrane protein PEX14, Pex14 ELISA KIT

ELI-37738m 96 Tests
EUR 865

PEX14 Blocking Peptide

DF4284-BP 1mg
EUR 195

PEX14 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PEX14 cloning plasmid

CSB-CL017800HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atggcgtcctcggagcaggcagagcagccgagccagccaagctctactccaggaagtgaaaatgtgctgcctcgagagccgctgattgccacggcagtgaagtttctacagaattcccgggtccgccagagcccacttgcaaccaggagagcattcctaaagaagaaagggctga
  • Show more
Description: A cloning plasmid for the PEX14 gene.

Anti-PEX14 (1G12)

YF-MA14671 100 ug
EUR 363
Description: Mouse monoclonal to PEX14


EF001689 96 Tests
EUR 689

Mouse PEX14 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PEX14 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PEX14 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PEX14 Recombinant Protein (Human)

RP023131 100 ug Ask for price

PEX14 Recombinant Protein (Mouse)

RP161384 100 ug Ask for price

PEX14 Recombinant Protein (Rat)

RP220085 100 ug Ask for price

Peroxisomal Biogenesis Factor 14 (PEX14) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 14 (PEX14) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 14 (PEX14) Antibody

abx026888-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 14 (PEX14) Antibody

abx026888-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 14 (PEX14) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • EUR 70.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • 5 ug
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 14 (PEX14) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 14 (PEX14) Antibody

abx036238-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 14 (PEX14) Antibody

abx034246-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 14 (PEX14) Antibody

abx034246-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 14 (PEX14) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 14 (PEX14) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 14 (PEX14) Antibody

abx236327-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Peroxisomal Biogenesis Factor 14 (PEX14) Antibody

abx331597-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 14 (PEX14) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pex14 ORF Vector (Rat) (pORF)

ORF073363 1.0 ug DNA
EUR 506

PEX14 ORF Vector (Human) (pORF)

ORF007711 1.0 ug DNA
EUR 95

Pex14 ORF Vector (Mouse) (pORF)

ORF053796 1.0 ug DNA
EUR 506

Pex14 sgRNA CRISPR Lentivector set (Rat)

K7067601 3 x 1.0 ug
EUR 339

PEX14 sgRNA CRISPR Lentivector set (Human)

K1629701 3 x 1.0 ug
EUR 339

Pex14 sgRNA CRISPR Lentivector set (Mouse)

K4712301 3 x 1.0 ug
EUR 339

Pex14 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7067602 1.0 ug DNA
EUR 154

Pex14 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7067603 1.0 ug DNA
EUR 154

Pex14 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7067604 1.0 ug DNA
EUR 154

PEX14 sgRNA CRISPR Lentivector (Human) (Target 1)

K1629702 1.0 ug DNA
EUR 154

PEX14 sgRNA CRISPR Lentivector (Human) (Target 2)

K1629703 1.0 ug DNA
EUR 154

PEX14 sgRNA CRISPR Lentivector (Human) (Target 3)

K1629704 1.0 ug DNA
EUR 154

Pex14 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4712302 1.0 ug DNA
EUR 154

Pex14 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4712303 1.0 ug DNA
EUR 154

Pex14 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4712304 1.0 ug DNA
EUR 154

PEX14 Protein Vector (Rat) (pPB-C-His)

PV293450 500 ng
EUR 603

PEX14 Protein Vector (Rat) (pPB-N-His)

PV293451 500 ng
EUR 603

PEX14 Protein Vector (Rat) (pPM-C-HA)

PV293452 500 ng
EUR 603

PEX14 Protein Vector (Rat) (pPM-C-His)

PV293453 500 ng
EUR 603

PEX14 Protein Vector (Mouse) (pPB-C-His)

PV215182 500 ng
EUR 603

PEX14 Protein Vector (Mouse) (pPB-N-His)

PV215183 500 ng
EUR 603

PEX14 Protein Vector (Mouse) (pPM-C-HA)

PV215184 500 ng
EUR 603

PEX14 Protein Vector (Mouse) (pPM-C-His)

PV215185 500 ng
EUR 603

PEX14 Protein Vector (Human) (pPB-C-His)

PV030841 500 ng
EUR 329

PEX14 Protein Vector (Human) (pPB-N-His)

PV030842 500 ng
EUR 329

PEX14 Protein Vector (Human) (pPM-C-HA)

PV030843 500 ng
EUR 329

PEX14 Protein Vector (Human) (pPM-C-His)

PV030844 500 ng
EUR 329

Pex14 3'UTR Luciferase Stable Cell Line

TU116210 1.0 ml Ask for price

Pex14 3'UTR GFP Stable Cell Line

TU166210 1.0 ml Ask for price

Pex14 3'UTR Luciferase Stable Cell Line

TU216095 1.0 ml Ask for price

Pex14 3'UTR GFP Stable Cell Line

TU266095 1.0 ml Ask for price

PEX14 3'UTR GFP Stable Cell Line

TU067755 1.0 ml
EUR 2333

PEX14 3'UTR Luciferase Stable Cell Line

TU017755 1.0 ml
EUR 2333

Human Peroxisomal Biogenesis Factor 14 (PEX14) ELISA Kit

abx382160-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PEX14 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV693781 1.0 ug DNA
EUR 682

PEX14 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV693785 1.0 ug DNA
EUR 682

PEX14 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV693786 1.0 ug DNA
EUR 682

Recombinant Pichia pastoris PEX14 Protein (aa 1-425)

VAng-Cr6650-1mgEcoli 1 mg (E. coli)
EUR 4903
Description: Pichia pastoris Peroxisomal membrane protein PEX14 (PEX14), recombinant protein.

Recombinant Pichia pastoris PEX14 Protein (aa 1-425)

VAng-Cr6650-500gEcoli 500 µg (E. coli)
EUR 3459
Description: Pichia pastoris Peroxisomal membrane protein PEX14 (PEX14), recombinant protein.

Recombinant Pichia pastoris PEX14 Protein (aa 1-425)

VAng-Cr6650-50gEcoli 50 µg (E. coli)
EUR 2360
Description: Pichia pastoris Peroxisomal membrane protein PEX14 (PEX14), recombinant protein.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)


PEX14 Rabbit Polyclonal Antibody