PCBP2 Rabbit Polyclonal Antibody

PCBP2 Rabbit Polyclonal Antibody


PCBP2 Polyclonal Antibody

ABP59843-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PCBP2 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PCBP2 from Human, Mouse. This PCBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCBP2 protein at amino acid sequence of 30-110

PCBP2 Polyclonal Antibody

ABP59843-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PCBP2 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PCBP2 from Human, Mouse. This PCBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCBP2 protein at amino acid sequence of 30-110

PCBP2 Rabbit pAb

A2531-100ul 100 ul
EUR 308

PCBP2 Rabbit pAb

A2531-200ul 200 ul
EUR 459

PCBP2 Rabbit pAb

A2531-20ul 20 ul
EUR 183

PCBP2 Rabbit pAb

A2531-50ul 50 ul
EUR 223

PCBP2 Antibody

ABD6991 100 ug
EUR 438

PCBP2 Antibody

32696-100ul 100ul
EUR 252

PCBP2 antibody

22117-100ul 100ul
EUR 390

PCBP2 antibody

70R-19135 50 ul
EUR 435
Description: Rabbit polyclonal PCBP2 antibody

PCBP2 antibody

70R-13182 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PCBP2 antibody

PCBP2 antibody

70R-13611 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PCBP2 antibody

PCBP2 antibody

70R-1378 100 ug
EUR 377
Description: Rabbit polyclonal PCBP2 antibody

PCBP2 antibody

70R-1465 100 ug
EUR 377
Description: Rabbit polyclonal PCBP2 antibody

PCBP2 Antibody

DF6991 200ul
EUR 304
Description: PCBP2 Antibody detects endogenous levels of total PCBP2.

PCBP2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500

PCBP2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PCBP2 Conjugated Antibody

C32696 100ul
EUR 397

anti- PCBP2 antibody

FNab06191 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: poly(rC) binding protein 2
  • Uniprot ID: Q15366
  • Gene ID: 5094
  • Research Area: Immunology, Metabolism
Description: Antibody raised against PCBP2

Anti-PCBP2 antibody

PAab06191 100 ug
EUR 355

Anti-PCBP2 antibody

STJ24914 100 µl
EUR 277
Description: The protein encoded by this gene appears to be multifunctional. Along with PCBP-1 and hnRNPK, it is one of the major cellular poly(rC)-binding proteins. The encoded protein contains three K-homologous (KH) domains which may be involved in RNA binding. Together with PCBP-1, this protein also functions as a translational coactivator of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES, promoting poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. This multiexon structural mRNA is thought to be retrotransposed to generate PCBP-1, an intronless gene with functions similar to that of PCBP2. This gene and PCBP-1 have paralogous genes (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. Thsi gene also has two processed pseudogenes (PCBP2P1 and PCBP2P2). Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-PCBP2 antibody

STJ190223 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PCBP2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13628 100 ul
EUR 403
Description: Rabbit polyclonal to PCBP2

PCBP2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PCBP2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PCBP2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PCBP2 Blocking Peptide

33R-4463 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PCBP2 antibody, catalog no. 70R-1465

PCBP2 Blocking Peptide

33R-9591 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PCBP2 antibody, catalog no. 70R-1378

PCBP2 Blocking Peptide

DF6991-BP 1mg
EUR 195

PCBP2 cloning plasmid

CSB-CL622995HU1-10ug 10ug
EUR 415
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1089
  • Sequence: atggacaccggtgtgattgaaggtggattaaatgtcactctcaccatccggctacttatgcatggaaaggaagttggcagtatcatcggaaagaaaggagaatcagttaagaagatgcgcgaggagagtggtgcacgtatcaacatctcagaagggaattgtcctgagagaatta
  • Show more
Description: A cloning plasmid for the PCBP2 gene.

PCBP2 cloning plasmid

CSB-CL622995HU2-10ug 10ug
EUR 418
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1101
  • Sequence: atggacaccggtgtgattgaaggtggattaaatgtcactctcaccatccggctacttatgcatggaaaggaagttggcagtatcatcggaaagaaaggagaatcagttaagaagatgcgcgaggagagtggtgcacgtatcaacatctcagaagggaattgtcctgagagaatta
  • Show more
Description: A cloning plasmid for the PCBP2 gene.

Anti-PCBP2 (5F12)

YF-MA10666 100 ug
EUR 363
Description: Mouse monoclonal to PCBP2


EF001592 96 Tests
EUR 689

Human PCBP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PCBP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PCBP2 Recombinant Protein (Human)

RP022663 100 ug Ask for price

PCBP2 Recombinant Protein (Human)

RP022666 100 ug Ask for price

PCBP2 Recombinant Protein (Rat)

RP219440 100 ug Ask for price

PCBP2 Recombinant Protein (Mouse)

RP160352 100 ug Ask for price

PCBP2 Recombinant Protein (Mouse)

RP160355 100 ug Ask for price

PCBP2 Recombinant Protein (Mouse)

RP160358 100 ug Ask for price

PCBP2 Recombinant Protein (Mouse)

RP160361 100 ug Ask for price

Monoclonal PCBP2 Antibody (monoclonal) (M02), Clone: 1B6

APR10965G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PCBP2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1B6. This antibody is applicable in WB, E

Monoclonal PCBP2 Antibody (monoclonal) (M07), Clone: 5F12

APG02955G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PCBP2 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 5F12. This antibody is applicable in WB, IHC and IF, E

Poly(Rc) Binding Protein 2 (PCBP2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 2 (PCBP2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 2 (PCBP2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 2 (PCBP2) Antibody

abx236191-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

PCBP2 ORF Vector (Human) (pORF)

ORF007555 1.0 ug DNA
EUR 95

PCBP2 ORF Vector (Human) (pORF)

ORF007556 1.0 ug DNA
EUR 95

h PCBP2 inducible lentiviral particles

LVP278 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PCBP2, is fully sequence verified and matched to NCBI accession ID: NM_031989.4

Pcbp2 ORF Vector (Rat) (pORF)

ORF073148 1.0 ug DNA
EUR 506

Pcbp2 ORF Vector (Mouse) (pORF)

ORF053452 1.0 ug DNA
EUR 506

Pcbp2 ORF Vector (Mouse) (pORF)

ORF053453 1.0 ug DNA
EUR 506

Pcbp2 ORF Vector (Mouse) (pORF)

ORF053454 1.0 ug DNA
EUR 506

Pcbp2 ORF Vector (Mouse) (pORF)

ORF053455 1.0 ug DNA
EUR 506

Anti-PCBP2/hnRNP E2 (1B6)

YF-MA14610 100 ug
EUR 363
Description: Mouse monoclonal to PCBP2/hnRNP E2

Anti-PCBP2/hnRNP E2 (3A1)

YF-MA14611 100 ug
EUR 363
Description: Mouse monoclonal to PCBP2/hnRNP E2

Anti-PCBP2/hnRNP E2 (1C7)

YF-MA14612 100 ug
EUR 363
Description: Mouse monoclonal to PCBP2/hnRNP E2

Anti-PCBP2/hnRNP E2 (6B6)

YF-MA14613 100 ug
EUR 363
Description: Mouse monoclonal to PCBP2/hnRNP E2

Anti-PCBP2/hnRNP E2 (6E9)

YF-MA14614 100 ug
EUR 363
Description: Mouse monoclonal to PCBP2/hnRNP E2

Poly(RC) Binding Protein 2 (PCBP2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 2 (PCBP2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 2 (PCBP2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PCBP2 sgRNA CRISPR Lentivector set (Human)

K1601201 3 x 1.0 ug
EUR 339

Pcbp2 sgRNA CRISPR Lentivector set (Mouse)

K4799401 3 x 1.0 ug
EUR 339

Pcbp2 sgRNA CRISPR Lentivector set (Rat)

K6494301 3 x 1.0 ug
EUR 339

Monoclonal HNRNP-E2 / PCBP2 Antibody (clone 5F12), Clone: 5F12

AMM05385G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human HNRNP-E2 / PCBP2 (clone 5F12). The antibodies are raised in Mouse and are from clone 5F12. This antibody is applicable in WB and IHC-P, IF, E, RNAi

PCBP2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1601202 1.0 ug DNA
EUR 154

PCBP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1601203 1.0 ug DNA
EUR 154

PCBP2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1601204 1.0 ug DNA
EUR 154

Pcbp2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4799402 1.0 ug DNA
EUR 154

Pcbp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4799403 1.0 ug DNA
EUR 154

Pcbp2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4799404 1.0 ug DNA
EUR 154

Pcbp2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6494302 1.0 ug DNA
EUR 154

Pcbp2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6494303 1.0 ug DNA
EUR 154

Pcbp2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6494304 1.0 ug DNA
EUR 154

PCBP2 Protein Vector (Human) (pPB-C-His)

PV030217 500 ng
EUR 329

PCBP2 Protein Vector (Human) (pPB-N-His)

PV030218 500 ng
EUR 329

PCBP2 Protein Vector (Human) (pPM-C-HA)

PV030219 500 ng
EUR 329

PCBP2 Protein Vector (Human) (pPM-C-His)

PV030220 500 ng
EUR 329

PCBP2 Protein Vector (Human) (pPB-C-His)

PV030221 500 ng
EUR 329

PCBP2 Protein Vector (Human) (pPB-N-His)

PV030222 500 ng
EUR 329

PCBP2 Protein Vector (Human) (pPM-C-HA)

PV030223 500 ng
EUR 329

PCBP2 Protein Vector (Human) (pPM-C-His)

PV030224 500 ng
EUR 329

PCBP2 Protein Vector (Mouse) (pPB-C-His)

PV213806 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-N-His)

PV213807 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-HA)

PV213808 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-His)

PV213809 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-C-His)

PV213810 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-N-His)

PV213811 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-HA)

PV213812 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-His)

PV213813 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-C-His)

PV213814 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-N-His)

PV213815 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-HA)

PV213816 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-His)

PV213817 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-C-His)

PV213818 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-N-His)

PV213819 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-HA)

PV213820 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-His)

PV213821 500 ng
EUR 603

PCBP2 Protein Vector (Rat) (pPB-C-His)

PV292590 500 ng
EUR 603

PCBP2 Protein Vector (Rat) (pPB-N-His)

PV292591 500 ng
EUR 603

PCBP2 Protein Vector (Rat) (pPM-C-HA)

PV292592 500 ng
EUR 603

PCBP2 Protein Vector (Rat) (pPM-C-His)

PV292593 500 ng
EUR 603

Pcbp2 3'UTR GFP Stable Cell Line

TU165962 1.0 ml Ask for price

PCBP2 3'UTR Luciferase Stable Cell Line

TU017465 1.0 ml
EUR 1521

Pcbp2 3'UTR Luciferase Stable Cell Line

TU115962 1.0 ml Ask for price

PCBP2 3'UTR GFP Stable Cell Line

TU067465 1.0 ml
EUR 1521

Pcbp2 3'UTR GFP Stable Cell Line

TU265860 1.0 ml Ask for price

Pcbp2 3'UTR Luciferase Stable Cell Line

TU215860 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC


PCBP2 Rabbit Polyclonal Antibody