PCBP2 Rabbit Polyclonal Antibody
 PCBP2 Polyclonal Antibody |
|
ABP59843-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PCBP2 protein at amino acid sequence of 30-110
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PCBP2 from Human, Mouse. This PCBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCBP2 protein at amino acid sequence of 30-110 |
PCBP2 Polyclonal Antibody |
|
ABP59843-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PCBP2 protein at amino acid sequence of 30-110
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PCBP2 from Human, Mouse. This PCBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCBP2 protein at amino acid sequence of 30-110 |
 PCBP2 Rabbit pAb |
|
A2531-100ul |
Abclonal |
100 ul |
EUR 308 |
PCBP2 Rabbit pAb |
|
A2531-200ul |
Abclonal |
200 ul |
EUR 459 |
PCBP2 Rabbit pAb |
|
A2531-20ul |
Abclonal |
20 ul |
EUR 183 |
PCBP2 Rabbit pAb |
|
A2531-50ul |
Abclonal |
50 ul |
EUR 223 |
 PCBP2 Antibody |
|
32696-100ul |
SAB |
100ul |
EUR 252 |
 PCBP2 antibody |
|
22117-100ul |
SAB |
100ul |
EUR 390 |
PCBP2 antibody |
|
70R-19135 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal PCBP2 antibody |
PCBP2 antibody |
|
70R-13182 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal PCBP2 antibody |
PCBP2 antibody |
|
70R-13611 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal PCBP2 antibody |
PCBP2 antibody |
|
70R-1378 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal PCBP2 antibody |
PCBP2 antibody |
|
70R-1465 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal PCBP2 antibody |
PCBP2 Antibody |
|
DF6991 |
Affbiotech |
200ul |
EUR 304 |
|
Description: PCBP2 Antibody detects endogenous levels of total PCBP2. |
PCBP2 Antibody |
|
1-CSB-PA622995LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500 |
PCBP2 Antibody |
|
1-CSB-PA017517GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 PCBP2 Conjugated Antibody |
|
C32696 |
SAB |
100ul |
EUR 397 |
 anti- PCBP2 antibody |
|
FNab06191 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:1000 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: poly(rC) binding protein 2
- Uniprot ID: Q15366
- Gene ID: 5094
- Research Area: Immunology, Metabolism
|
|
Description: Antibody raised against PCBP2 |
 Anti-PCBP2 antibody |
|
STJ24914 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene appears to be multifunctional. Along with PCBP-1 and hnRNPK, it is one of the major cellular poly(rC)-binding proteins. The encoded protein contains three K-homologous (KH) domains which may be involved in RNA binding. Together with PCBP-1, this protein also functions as a translational coactivator of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES, promoting poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. This multiexon structural mRNA is thought to be retrotransposed to generate PCBP-1, an intronless gene with functions similar to that of PCBP2. This gene and PCBP-1 have paralogous genes (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. Thsi gene also has two processed pseudogenes (PCBP2P1 and PCBP2P2). Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-PCBP2 antibody |
|
STJ190223 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PCBP2 |
 PCBP2 siRNA |
|
20-abx927849 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PCBP2 siRNA |
|
20-abx927850 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-PCBP2 |
|
YF-PA13628 |
Abfrontier |
100 ul |
EUR 403 |
|
Description: Rabbit polyclonal to PCBP2 |
 PCBP2 Antibody, HRP conjugated |
|
1-CSB-PA622995LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 PCBP2 Antibody, FITC conjugated |
|
1-CSB-PA622995LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 PCBP2 Antibody, Biotin conjugated |
|
1-CSB-PA622995LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 PCBP2 Blocking Peptide |
|
33R-4463 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PCBP2 antibody, catalog no. 70R-1465 |
PCBP2 Blocking Peptide |
|
33R-9591 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PCBP2 antibody, catalog no. 70R-1378 |
PCBP2 Blocking Peptide |
|
DF6991-BP |
Affbiotech |
1mg |
EUR 195 |
 PCBP2 cloning plasmid |
|
CSB-CL622995HU1-10ug |
Cusabio |
10ug |
EUR 415 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1089
- Sequence: atggacaccggtgtgattgaaggtggattaaatgtcactctcaccatccggctacttatgcatggaaaggaagttggcagtatcatcggaaagaaaggagaatcagttaagaagatgcgcgaggagagtggtgcacgtatcaacatctcagaagggaattgtcctgagagaatta
- Show more
|
|
Description: A cloning plasmid for the PCBP2 gene. |
PCBP2 cloning plasmid |
|
CSB-CL622995HU2-10ug |
Cusabio |
10ug |
EUR 418 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1101
- Sequence: atggacaccggtgtgattgaaggtggattaaatgtcactctcaccatccggctacttatgcatggaaaggaagttggcagtatcatcggaaagaaaggagaatcagttaagaagatgcgcgaggagagtggtgcacgtatcaacatctcagaagggaattgtcctgagagaatta
- Show more
|
|
Description: A cloning plasmid for the PCBP2 gene. |
) Anti-PCBP2 (5F12) |
|
YF-MA10666 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to PCBP2 |
 Human PCBP2 shRNA Plasmid |
|
20-abx953388 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse PCBP2 shRNA Plasmid |
|
20-abx971941 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) PCBP2 Recombinant Protein (Human) |
|
RP022663 |
ABM |
100 ug |
Ask for price |
PCBP2 Recombinant Protein (Human) |
|
RP022666 |
ABM |
100 ug |
Ask for price |
) PCBP2 Recombinant Protein (Rat) |
|
RP219440 |
ABM |
100 ug |
Ask for price |
) PCBP2 Recombinant Protein (Mouse) |
|
RP160352 |
ABM |
100 ug |
Ask for price |
PCBP2 Recombinant Protein (Mouse) |
|
RP160355 |
ABM |
100 ug |
Ask for price |
PCBP2 Recombinant Protein (Mouse) |
|
RP160358 |
ABM |
100 ug |
Ask for price |
PCBP2 Recombinant Protein (Mouse) |
|
RP160361 |
ABM |
100 ug |
Ask for price |
 (M02), Clone: 1B6) Monoclonal PCBP2 Antibody (monoclonal) (M02), Clone: 1B6 |
|
APR10965G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human PCBP2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1B6. This antibody is applicable in WB, E |
 (M07), Clone: 5F12) Monoclonal PCBP2 Antibody (monoclonal) (M07), Clone: 5F12 |
|
APG02955G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human PCBP2 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 5F12. This antibody is applicable in WB, IHC and IF, E |
 Binding Protein 2 (PCBP2) Antibody) Poly(Rc) Binding Protein 2 (PCBP2) Antibody |
|
20-abx114578 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Binding Protein 2 (PCBP2) Antibody) Poly(RC) Binding Protein 2 (PCBP2) Antibody |
|
20-abx001971 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Poly(RC) Binding Protein 2 (PCBP2) Antibody |
|
20-abx338495 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Poly(RC) Binding Protein 2 (PCBP2) Antibody |
|
abx236191-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 (pORF)) PCBP2 ORF Vector (Human) (pORF) |
|
ORF007555 |
ABM |
1.0 ug DNA |
EUR 95 |
PCBP2 ORF Vector (Human) (pORF) |
|
ORF007556 |
ABM |
1.0 ug DNA |
EUR 95 |
 h PCBP2 inducible lentiviral particles |
|
LVP278 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
|
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PCBP2, is fully sequence verified and matched to NCBI accession ID: NM_031989.4 |
 (pORF)) Pcbp2 ORF Vector (Rat) (pORF) |
|
ORF073148 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Pcbp2 ORF Vector (Mouse) (pORF) |
|
ORF053452 |
ABM |
1.0 ug DNA |
EUR 506 |
Pcbp2 ORF Vector (Mouse) (pORF) |
|
ORF053453 |
ABM |
1.0 ug DNA |
EUR 506 |
Pcbp2 ORF Vector (Mouse) (pORF) |
|
ORF053454 |
ABM |
1.0 ug DNA |
EUR 506 |
Pcbp2 ORF Vector (Mouse) (pORF) |
|
ORF053455 |
ABM |
1.0 ug DNA |
EUR 506 |
) Anti-PCBP2/hnRNP E2 (1B6) |
|
YF-MA14610 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to PCBP2/hnRNP E2 |
) Anti-PCBP2/hnRNP E2 (3A1) |
|
YF-MA14611 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to PCBP2/hnRNP E2 |
) Anti-PCBP2/hnRNP E2 (1C7) |
|
YF-MA14612 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to PCBP2/hnRNP E2 |
) Anti-PCBP2/hnRNP E2 (6B6) |
|
YF-MA14613 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to PCBP2/hnRNP E2 |
) Anti-PCBP2/hnRNP E2 (6E9) |
|
YF-MA14614 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to PCBP2/hnRNP E2 |
 Binding Protein 2 (PCBP2) Antibody (HRP)) Poly(RC) Binding Protein 2 (PCBP2) Antibody (HRP) |
|
20-abx337084 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Binding Protein 2 (PCBP2) Antibody (FITC)) Poly(RC) Binding Protein 2 (PCBP2) Antibody (FITC) |
|
20-abx337085 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Binding Protein 2 (PCBP2) Antibody (Biotin)) Poly(RC) Binding Protein 2 (PCBP2) Antibody (Biotin) |
|
20-abx337086 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) PCBP2 sgRNA CRISPR Lentivector set (Human) |
|
K1601201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Pcbp2 sgRNA CRISPR Lentivector set (Mouse) |
|
K4799401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Pcbp2 sgRNA CRISPR Lentivector set (Rat) |
|
K6494301 |
ABM |
3 x 1.0 ug |
EUR 339 |
, Clone: 5F12) Monoclonal HNRNP-E2 / PCBP2 Antibody (clone 5F12), Clone: 5F12 |
|
AMM05385G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A Monoclonal antibody against Human HNRNP-E2 / PCBP2 (clone 5F12). The antibodies are raised in Mouse and are from clone 5F12. This antibody is applicable in WB and IHC-P, IF, E, RNAi |
 (Target 1)) PCBP2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1601202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) PCBP2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1601203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) PCBP2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1601204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Pcbp2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4799402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pcbp2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4799403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pcbp2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4799404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Pcbp2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6494302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pcbp2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6494303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pcbp2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6494304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) PCBP2 Protein Vector (Human) (pPB-C-His) |
|
PV030217 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) PCBP2 Protein Vector (Human) (pPB-N-His) |
|
PV030218 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) PCBP2 Protein Vector (Human) (pPM-C-HA) |
|
PV030219 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) PCBP2 Protein Vector (Human) (pPM-C-His) |
|
PV030220 |
ABM |
500 ng |
EUR 329 |
PCBP2 Protein Vector (Human) (pPB-C-His) |
|
PV030221 |
ABM |
500 ng |
EUR 329 |
PCBP2 Protein Vector (Human) (pPB-N-His) |
|
PV030222 |
ABM |
500 ng |
EUR 329 |
PCBP2 Protein Vector (Human) (pPM-C-HA) |
|
PV030223 |
ABM |
500 ng |
EUR 329 |
PCBP2 Protein Vector (Human) (pPM-C-His) |
|
PV030224 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) PCBP2 Protein Vector (Mouse) (pPB-C-His) |
|
PV213806 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PCBP2 Protein Vector (Mouse) (pPB-N-His) |
|
PV213807 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PCBP2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV213808 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PCBP2 Protein Vector (Mouse) (pPM-C-His) |
|
PV213809 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPB-C-His) |
|
PV213810 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPB-N-His) |
|
PV213811 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV213812 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPM-C-His) |
|
PV213813 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPB-C-His) |
|
PV213814 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPB-N-His) |
|
PV213815 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV213816 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPM-C-His) |
|
PV213817 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPB-C-His) |
|
PV213818 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPB-N-His) |
|
PV213819 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV213820 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPM-C-His) |
|
PV213821 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) PCBP2 Protein Vector (Rat) (pPB-C-His) |
|
PV292590 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PCBP2 Protein Vector (Rat) (pPB-N-His) |
|
PV292591 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PCBP2 Protein Vector (Rat) (pPM-C-HA) |
|
PV292592 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PCBP2 Protein Vector (Rat) (pPM-C-His) |
|
PV292593 |
ABM |
500 ng |
EUR 603 |
 Pcbp2 3'UTR GFP Stable Cell Line |
|
TU165962 |
ABM |
1.0 ml |
Ask for price |
 PCBP2 3'UTR Luciferase Stable Cell Line |
|
TU017465 |
ABM |
1.0 ml |
EUR 1521 |
 Pcbp2 3'UTR Luciferase Stable Cell Line |
|
TU115962 |
ABM |
1.0 ml |
Ask for price |
 PCBP2 3'UTR GFP Stable Cell Line |
|
TU067465 |
ABM |
1.0 ml |
EUR 1521 |
Pcbp2 3'UTR GFP Stable Cell Line |
|
TU265860 |
ABM |
1.0 ml |
Ask for price |
Pcbp2 3'UTR Luciferase Stable Cell Line |
|
TU215860 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
PCBP2 Rabbit Polyclonal Antibody
