PCBP1 Rabbit Polyclonal Antibody
PCBP1 Polyclonal Antibody |
ABP59842-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PCBP1 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of PCBP1 from Human, Mouse. This PCBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCBP1 protein at amino acid sequence of 30-110 |
PCBP1 Polyclonal Antibody |
ABP59842-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PCBP1 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of PCBP1 from Human, Mouse. This PCBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCBP1 protein at amino acid sequence of 30-110 |
PCBP1 Polyclonal Antibody |
ABP59842-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PCBP1 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of PCBP1 from Human, Mouse. This PCBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCBP1 protein at amino acid sequence of 30-110 |
PCBP1 Polyclonal Antibody |
A64658 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
PCBP1 Polyclonal Antibody |
27441-100ul |
SAB |
100ul |
EUR 252 |
PCBP1 Polyclonal Antibody |
27441-50ul |
SAB |
50ul |
EUR 187 |
PCBP1 Rabbit pAb |
A1044-100ul |
Abclonal |
100 ul |
EUR 308 |
PCBP1 Rabbit pAb |
A1044-200ul |
Abclonal |
200 ul |
EUR 459 |
PCBP1 Rabbit pAb |
A1044-20ul |
Abclonal |
20 ul |
EUR 183 |
PCBP1 Rabbit pAb |
A1044-50ul |
Abclonal |
50 ul |
EUR 223 |
PCBP1 Polyclonal Conjugated Antibody |
C27441 |
SAB |
100ul |
EUR 397 |
PCBP1 antibody |
70R-4995 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PCBP1 antibody |
PCBP1 Antibody |
39508-100ul |
SAB |
100ul |
EUR 390 |
PCBP1 antibody |
10R-10236 |
Fitzgerald |
50 ul |
EUR 241 |
Description: Mouse monoclonal PCBP1 antibody |
PCBP1 antibody |
70R-1466 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal PCBP1 antibody |
PCBP1 Antibody |
1-CSB-PA613590LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PCBP1. Recognizes PCBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
PCBP1 Antibody |
1-CSB-PA017516GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PCBP1. Recognizes PCBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
PCBP1 Polyclonal Antibody, HRP Conjugated |
A64659 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
PCBP1 Polyclonal Antibody, FITC Conjugated |
A64660 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
PCBP1 Polyclonal Antibody, Biotin Conjugated |
A64661 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Anti-PCBP1 antibody |
STJ111059 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This intronless gene is thought to have been generated by retrotransposition of a fully processed PCBP-2 mRNA. This gene and PCBP-2 have paralogues (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. The protein encoded by this gene appears to be multifunctional. It along with PCBP-2 and hnRNPK corresponds to the major cellular poly(rC)-binding protein. It contains three K-homologous (KH) domains which may be involved in RNA binding. This encoded protein together with PCBP-2 also functions as translational coactivators of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES and promote poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human Papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. |
Anti-PCBP1 antibody |
STJ190222 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PCBP1 |
PCBP1 siRNA |
20-abx927847 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PCBP1 siRNA |
20-abx927848 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PCBP1 |
YF-PA24311 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PCBP1 |
PCBP1 Antibody, HRP conjugated |
1-CSB-PA613590LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PCBP1. Recognizes PCBP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PCBP1 Antibody, FITC conjugated |
1-CSB-PA613590LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PCBP1. Recognizes PCBP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PCBP1 Antibody, Biotin conjugated |
1-CSB-PA613590LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PCBP1. Recognizes PCBP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PCBP1 cloning plasmid |
CSB-CL613590HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1071
- Sequence: atggatgccggtgtgactgaaagtggactaaatgtgactctcaccattcggcttcttatgcacggaaaggaagtaggaagcatcattgggaagaaaggggagtcggttaagaggatccgcgaggagagtggcgcgcggatcaacatctcggaggggaattgtccggagagaatca
- Show more
|
Description: A cloning plasmid for the PCBP1 gene. |
PCBP1 Blocking Peptide |
33R-1804 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PCBP1 antibody, catalog no. 70R-1466 |
PCBP1 Blocking Peptide |
33R-7142 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PCBP1 antibody, catalog no. 70R-4995 |
Anti-PCBP1 (1G2) |
YF-MA20383 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to PCBP1 |
Anti-PCBP1 (1G2) |
YF-MA10665 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PCBP1 |
Mouse PCBP1 shRNA Plasmid |
20-abx973588 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PCBP1 shRNA Plasmid |
20-abx953387 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PCBP1 protein (His tag) |
80R-3020 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified recombinant PCBP1 protein (His tag) |
PCBP1 Recombinant Protein (Human) |
RP022660 |
ABM |
100 ug |
Ask for price |
PCBP1 Recombinant Protein (Mouse) |
RP160349 |
ABM |
100 ug |
Ask for price |
Poly(RC) Binding Protein 1 (PCBP1) Antibody |
20-abx126328 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Poly (RC) Binding Protein 1 (PCBP1) Antibody |
20-abx137477 |
Abbexa |
-
EUR 704.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Poly(RC) Binding Protein 1 (PCBP1) Antibody |
abx036852-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Poly(RC) Binding Protein 1 (PCBP1) Antibody |
abx030587-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Poly(RC) Binding Protein 1 (PCBP1) Antibody |
abx030587-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Poly(RC) Binding Protein 1 (PCBP1) Antibody |
20-abx306776 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Poly(RC) Binding Protein 1 (PCBP1) Antibody |
abx431792-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Poly(RC) Binding Protein 1 (PCBP1) Antibody |
abx431793-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
PCBP1 ORF Vector (Human) (pORF) |
ORF007554 |
ABM |
1.0 ug DNA |
EUR 95 |
Pcbp1 ORF Vector (Mouse) (pORF) |
ORF053451 |
ABM |
1.0 ug DNA |
EUR 506 |
PCBP1 Western Blot kit (AWBK40630) |
AWBK40630 |
Aviva Systems Biology |
10 reactions |
EUR 647 |
Description: - Description of target:
- Species reactivity:
- Application:
- Assay info:
- Sensitivity:
|
Poly(RC) Binding Protein 1 (PCBP1) Antibody (HRP) |
20-abx306777 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Poly(RC) Binding Protein 1 (PCBP1) Antibody (FITC) |
20-abx306778 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Poly(RC) Binding Protein 1 (PCBP1) Antibody (Biotin) |
20-abx306779 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PCBP1 sgRNA CRISPR Lentivector set (Human) |
K1601101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pcbp1 sgRNA CRISPR Lentivector set (Mouse) |
K4854101 |
ABM |
3 x 1.0 ug |
EUR 339 |
PCBP1-AS1 ORF Vector (Human) (pORF) |
ORF027451 |
ABM |
1.0 ug DNA |
Ask for price |
PCBP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1601102 |
ABM |
1.0 ug DNA |
EUR 154 |
PCBP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1601103 |
ABM |
1.0 ug DNA |
EUR 154 |
PCBP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1601104 |
ABM |
1.0 ug DNA |
EUR 154 |
Pcbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4854102 |
ABM |
1.0 ug DNA |
EUR 154 |
Pcbp1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4854103 |
ABM |
1.0 ug DNA |
EUR 154 |
Pcbp1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4854104 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Poly/rC Binding Protein 1 (PCBP1) |
4-RPE963Po01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: I3LEC2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 41.2kDa
- Isoelectric Point: 7
|
Description: Recombinant Pig Poly/rC Binding Protein 1 expressed in: E.coli |
Recombinant Human PCBP1 Protein, His, E.coli-1mg |
QP12972-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human PCBP1 Protein, His, E.coli-20ug |
QP12972-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human PCBP1 Protein, His, E.coli-5ug |
QP12972-5ug |
EnQuireBio |
5ug |
EUR 155 |
PCBP1 Protein Vector (Human) (pPB-C-His) |
PV030213 |
ABM |
500 ng |
EUR 329 |
PCBP1 Protein Vector (Human) (pPB-N-His) |
PV030214 |
ABM |
500 ng |
EUR 329 |
PCBP1 Protein Vector (Human) (pPM-C-HA) |
PV030215 |
ABM |
500 ng |
EUR 329 |
PCBP1 Protein Vector (Human) (pPM-C-His) |
PV030216 |
ABM |
500 ng |
EUR 329 |
PCBP1 Protein Vector (Mouse) (pPB-C-His) |
PV213802 |
ABM |
500 ng |
EUR 329 |
PCBP1 Protein Vector (Mouse) (pPB-N-His) |
PV213803 |
ABM |
500 ng |
EUR 329 |
PCBP1 Protein Vector (Mouse) (pPM-C-HA) |
PV213804 |
ABM |
500 ng |
EUR 329 |
PCBP1 Protein Vector (Mouse) (pPM-C-His) |
PV213805 |
ABM |
500 ng |
EUR 329 |
Pcbp1 3'UTR GFP Stable Cell Line |
TU165961 |
ABM |
1.0 ml |
Ask for price |
PCBP1 3'UTR Luciferase Stable Cell Line |
TU017464 |
ABM |
1.0 ml |
EUR 1394 |
Pcbp1 3'UTR Luciferase Stable Cell Line |
TU115961 |
ABM |
1.0 ml |
Ask for price |
PCBP1 3'UTR GFP Stable Cell Line |
TU067464 |
ABM |
1.0 ml |
EUR 1394 |
Pcbp1 3'UTR GFP Stable Cell Line |
TU265859 |
ABM |
1.0 ml |
Ask for price |
Pcbp1 3'UTR Luciferase Stable Cell Line |
TU215859 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
PCBP1 Rabbit Polyclonal Antibody