PASK Rabbit Polyclonal Antibody

PASK Rabbit Polyclonal Antibody

 

PASK Polyclonal Antibody

A70035 100 ?g
EUR 628.55
Description: fast delivery possible

PASK Polyclonal Antibody

31656-100ul 100ul
EUR 252

PASK Polyclonal Antibody

31656-50ul 50ul
EUR 187

PASK Rabbit pAb

A8995-100ul 100 ul
EUR 308

PASK Rabbit pAb

A8995-200ul 200 ul
EUR 459

PASK Rabbit pAb

A8995-20ul 20 ul
EUR 183

PASK Rabbit pAb

A8995-50ul 50 ul
EUR 223

PASK Polyclonal Conjugated Antibody

C31656 100ul
EUR 397

PASK Antibody

ABD13196 100 ug
EUR 438

PASK antibody

22236-100ul 100ul
EUR 390

PASK antibody

10R-5159 100 ul
EUR 691
Description: Mouse monoclonal PASK antibody

PASK antibody

10R-5160 100 ul
EUR 691
Description: Mouse monoclonal PASK antibody

PASK antibody

10R-5161 100 ul
EUR 726
Description: Mouse monoclonal PASK antibody

PASK antibody

70R-13125 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PASK antibody

PASK Antibody

DF10342 200ul
EUR 304
Description: PASK Antibody detects endogenous levels of PASK.

PASK Antibody

1-CSB-PA822296LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500

PASK Polyclonal Antibody, HRP Conjugated

A70036 100 ?g
EUR 628.55
Description: reagents widely cited

PASK Polyclonal Antibody, FITC Conjugated

A70037 100 ?g
EUR 628.55
Description: Ask the seller for details

PASK Polyclonal Antibody, Biotin Conjugated

A70038 100 ?g
EUR 628.55
Description: The best epigenetics products

PASK (Phospho-Thr1165) Polyclonal Conjugated Antibody

C12526 100ul
EUR 397

anti- PASK antibody

FNab06165 100µg
EUR 505.25
  • Immunogen: PAS domain containing serine/threonine kinase
  • Uniprot ID: Q96RG2
  • Gene ID: 23178
  • Research Area: Signal Transduction
Description: Antibody raised against PASK

PASK (pT1165) Antibody

abx217647-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-PASK antibody

PAab06165 100 ug
EUR 355

Anti-PASK antibody

STJ116338 100 µl
EUR 277
Description: This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-PASK antibody

STJ190115 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PASK

PASK siRNA

20-abx927783
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PASK siRNA

20-abx927784
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PASK

YF-PA25847 50 ul
EUR 334
Description: Mouse polyclonal to PASK

Phospho-PASK (Thr1165) Antibody

AF8179 200ul
EUR 376
Description: PASK (Phospho-Thr1165) Antibody detects endogenous levels of PASK only when phosphorylated at Thr1165.

PASK (Phospho- Thr1165) Antibody

ABF8179 100 ug
EUR 438

PASK (Phospho-Thr1165) Antibody

12526-100ul 100ul
EUR 252

PASK (Phospho-Thr1165) Antibody

12526-50ul 50ul
EUR 187

PASK Antibody, HRP conjugated

1-CSB-PA822296LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PASK Antibody, FITC conjugated

1-CSB-PA822296LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PASK Antibody, Biotin conjugated

1-CSB-PA822296LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PASK Blocking Peptide

DF10342-BP 1mg
EUR 195

PASK cloning plasmid

CSB-CL822296HU1-10ug 10ug
EUR 1393
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3972
  • Sequence: atggaggacgggggcttaacagcctttgaagaggaccagagatgcctttcccagagcctccccttgccagtgtcagcagagggcccagctgcacagaccactgctgagcccagcaggtcgttttcctcagcccacagacacctgagcagaaggaatgggctttccagactctgcc
  • Show more
Description: A cloning plasmid for the PASK gene.

PASK cloning plasmid

CSB-CL822296HU2-10ug 10ug
EUR 1218
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3432
  • Sequence: ATGGAGGACGGGGGCTTAACAGCCTTTGAAGAGGACCAGAGATGCCTTTCCCAGAGCCTCCCCTTGCCAGTGTCAGCAGAGGGCCCAGCTGCACAGACCACTGCTGAGCCCAGCAGGTCGTTTTCCTCAGCCCACAGACACCTGAGCAGAAGGAATGGGCTTTCCAGACTCTGCC
  • Show more
Description: A cloning plasmid for the PASK gene.

pASK- IBA5plus++FUS

PVT10149 2 ug
EUR 266

 

PASK Rabbit Polyclonal Antibody