PASK Rabbit Polyclonal Antibody
PASK Polyclonal Antibody |
A70035 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
PASK Polyclonal Antibody |
31656-100ul |
SAB |
100ul |
EUR 252 |
PASK Polyclonal Antibody |
31656-50ul |
SAB |
50ul |
EUR 187 |
PASK Rabbit pAb |
A8995-100ul |
Abclonal |
100 ul |
EUR 308 |
PASK Rabbit pAb |
A8995-200ul |
Abclonal |
200 ul |
EUR 459 |
PASK Rabbit pAb |
A8995-20ul |
Abclonal |
20 ul |
EUR 183 |
PASK Rabbit pAb |
A8995-50ul |
Abclonal |
50 ul |
EUR 223 |
PASK Polyclonal Conjugated Antibody |
C31656 |
SAB |
100ul |
EUR 397 |
PASK antibody |
22236-100ul |
SAB |
100ul |
EUR 390 |
PASK antibody |
10R-5159 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PASK antibody |
PASK antibody |
10R-5160 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PASK antibody |
PASK antibody |
10R-5161 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal PASK antibody |
PASK antibody |
70R-13125 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal PASK antibody |
PASK Antibody |
DF10342 |
Affbiotech |
200ul |
EUR 304 |
Description: PASK Antibody detects endogenous levels of PASK. |
PASK Antibody |
1-CSB-PA822296LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500 |
PASK Polyclonal Antibody, HRP Conjugated |
A70036 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
PASK Polyclonal Antibody, FITC Conjugated |
A70037 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
PASK Polyclonal Antibody, Biotin Conjugated |
A70038 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
PASK (Phospho-Thr1165) Polyclonal Conjugated Antibody |
C12526 |
SAB |
100ul |
EUR 397 |
anti- PASK antibody |
FNab06165 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: PAS domain containing serine/threonine kinase
- Uniprot ID: Q96RG2
- Gene ID: 23178
- Research Area: Signal Transduction
|
Description: Antibody raised against PASK |
PASK (pT1165) Antibody |
abx217647-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Anti-PASK antibody |
STJ116338 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Anti-PASK antibody |
STJ190115 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PASK |
PASK siRNA |
20-abx927783 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PASK siRNA |
20-abx927784 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PASK |
YF-PA25847 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PASK |
Phospho-PASK (Thr1165) Antibody |
AF8179 |
Affbiotech |
200ul |
EUR 376 |
Description: PASK (Phospho-Thr1165) Antibody detects endogenous levels of PASK only when phosphorylated at Thr1165. |
PASK (Phospho-Thr1165) Antibody |
12526-100ul |
SAB |
100ul |
EUR 252 |
PASK (Phospho-Thr1165) Antibody |
12526-50ul |
SAB |
50ul |
EUR 187 |
PASK Antibody, HRP conjugated |
1-CSB-PA822296LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PASK Antibody, FITC conjugated |
1-CSB-PA822296LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PASK Antibody, Biotin conjugated |
1-CSB-PA822296LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PASK Blocking Peptide |
DF10342-BP |
Affbiotech |
1mg |
EUR 195 |
PASK cloning plasmid |
CSB-CL822296HU1-10ug |
Cusabio |
10ug |
EUR 1393 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3972
- Sequence: atggaggacgggggcttaacagcctttgaagaggaccagagatgcctttcccagagcctccccttgccagtgtcagcagagggcccagctgcacagaccactgctgagcccagcaggtcgttttcctcagcccacagacacctgagcagaaggaatgggctttccagactctgcc
- Show more
|
Description: A cloning plasmid for the PASK gene. |
PASK cloning plasmid |
CSB-CL822296HU2-10ug |
Cusabio |
10ug |
EUR 1218 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3432
- Sequence: ATGGAGGACGGGGGCTTAACAGCCTTTGAAGAGGACCAGAGATGCCTTTCCCAGAGCCTCCCCTTGCCAGTGTCAGCAGAGGGCCCAGCTGCACAGACCACTGCTGAGCCCAGCAGGTCGTTTTCCTCAGCCCACAGACACCTGAGCAGAAGGAATGGGCTTTCCAGACTCTGCC
- Show more
|
Description: A cloning plasmid for the PASK gene. |
PASK Rabbit Polyclonal Antibody