PAK6 Rabbit Polyclonal Antibody
PAK6 Polyclonal Antibody |
ABP59817-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of PAK6 from Human, Mouse. This PAK6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180 |
PAK6 Polyclonal Antibody |
ABP59817-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of PAK6 from Human, Mouse. This PAK6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180 |
PAK6 Polyclonal Antibody |
ES8980-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PAK6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PAK6 Polyclonal Antibody |
ES8980-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PAK6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PAK6 Rabbit pAb |
A7821-100ul |
Abclonal |
100 ul |
EUR 308 |
PAK6 Rabbit pAb |
A7821-200ul |
Abclonal |
200 ul |
EUR 459 |
PAK6 Rabbit pAb |
A7821-20ul |
Abclonal |
20 ul |
EUR 183 |
PAK6 Rabbit pAb |
A7821-50ul |
Abclonal |
50 ul |
EUR 223 |
PAK6 Rabbit pAb |
A4871-100ul |
Abclonal |
100 ul |
EUR 308 |
PAK6 Rabbit pAb |
A4871-200ul |
Abclonal |
200 ul |
EUR 459 |
PAK6 Rabbit pAb |
A4871-20ul |
Abclonal |
20 ul |
Ask for price |
PAK6 Rabbit pAb |
A4871-50ul |
Abclonal |
50 ul |
Ask for price |
Polyclonal PAK6 Antibody (Center) |
APR17746G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK6 (Center). This antibody is tested and proven to work in the following applications: |
PAK6 Antibody |
24181-100ul |
SAB |
100ul |
EUR 390 |
PAK6 antibody |
20R-1757 |
Fitzgerald |
100 ug |
EUR 673 |
Description: Rabbit polyclonal PAK6 antibody |
PAK6 antibody |
20R-PR073 |
Fitzgerald |
50 ug |
EUR 656 |
Description: Rabbit polyclonal PAK6 antibody |
PAK6 antibody |
70R-19099 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PAK6 antibody |
PAK6 antibody |
70R-12193 |
Fitzgerald |
100 ug |
EUR 403 |
Description: Rabbit polyclonal PAK6 antibody |
PAK6 antibody |
70R-14266 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Rabbit polyclonal PAK6 antibody |
PAK6 Antibody |
35865-100ul |
SAB |
100ul |
EUR 252 |
PAK6 Antibody |
1-CSB-PA927575 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PAK6. Recognizes PAK6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
PAK6 Antibody |
1-CSB-PA971648 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PAK6. Recognizes PAK6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:100 |
PAK6 Antibody |
1-CSB-PA865108ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against PAK6. Recognizes PAK6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
PAK6 Antibody |
DF10138 |
Affbiotech |
200ul |
EUR 304 |
Description: PAK6 Antibody detects endogenous levels of total PAK6. |
PAK6 Antibody |
1-CSB-PA017409GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PAK6. Recognizes PAK6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
PAK6 antibody |
70R-51044 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal PAK6 antibody |
PAK7/PAK6 Antibody |
1-CSB-PA040042 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against PAK7/PAK6. Recognizes PAK7/PAK6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000 |
PAK6 (pS165) Antibody |
abx217623-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
PAK6 Conjugated Antibody |
C35865 |
SAB |
100ul |
EUR 397 |
PAK7 / PAK6 Antibody |
20-abx325554 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti- PAK6 antibody |
FNab06124 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:100
- Immunogen: p21 protein (Cdc42/Rac)-activated kinase 6
- Uniprot ID: Q9NQU5
- Gene ID: 56924
- Research Area: Neuroscience, Metabolism
|
Description: Antibody raised against PAK6 |
Anti-PAK6 Antibody |
PA1729 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-PAK6 antibody |
STJ110131 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants. |
Anti-PAK6 antibody |
STJ24891 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants. |
Anti-PAK6 antibody |
STJ190138 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PAK6 |
PAK6 siRNA |
20-abx927649 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PAK6 siRNA |
20-abx927650 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PAK6 |
YF-PA20072 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to PAK6 |
anti-PAK6 |
YF-PA20073 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to PAK6 |
Phospho-PAK6 (Ser165) Antibody |
AF8297 |
Affbiotech |
200ul |
EUR 376 |
Description: PAK6 (Phospho-Ser165) Antibody detects endogenous levels of PAK6 only when phosphorylated at Ser165. |
PAK6 Blocking Peptide |
33R-10569 |
Fitzgerald |
50 ug |
EUR 349 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAK6 antibody, catalog no. 20R-1757 |
PAK6 Blocking Peptide |
33R-11001 |
Fitzgerald |
50 ug |
EUR 191 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAK6 antibody, catalog no. 70R-12193 |
PAK6 Blocking Peptide |
3927BP-50 |
Biovision |
|
EUR 153 |
PAK6 Blocking Peptide |
DF10138-BP |
Affbiotech |
1mg |
EUR 195 |
PAK6 Blocking Peptide |
20-abx063919 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PAK6 cloning plasmid |
CSB-CL865108HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2046
- Sequence: atgttccgcaagaaaaagaagaaacgccctgagatctcagcgccacagaacttccagcaccgtgtccacacctccttcgaccccaaagaaggcaagtttgtgggcctccccccacaatggcagaacatcctggacacactgcggcgccccaagcccgtggtggacccttcgcgaa
- Show more
|
Description: A cloning plasmid for the PAK6 gene. |
PAK7 / PAK6 (pS602 / S560) Antibody |
20-abx325465 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PAK7 / PAK6 (pS602 / pS560) Antibody |
abx333028-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
Phospho-PAK7/PAK6 (Ser602/Ser560) Antibody |
CSB-PA285604- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
Description: A polyclonal antibody against Phospho-PAK7/PAK6 (Ser602/Ser560). Recognizes Phospho-PAK7/PAK6 (Ser602/Ser560) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
Phospho-PAK7/PAK6 (Ser602/Ser560) Antibody |
CSB-PA285604-100ul |
Cusabio |
100ul |
EUR 362 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
Description: A polyclonal antibody against Phospho-PAK7/PAK6 (Ser602/Ser560). Recognizes Phospho-PAK7/PAK6 (Ser602/Ser560) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
Phospho-PAK7/PAK6 (S602/S560) Antibody |
1-CSB-PA040041 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-PAK7/PAK6 (S602/S560). Recognizes Phospho-PAK7/PAK6 (S602/S560) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
P21 Activated Kinase 6 (PAK6) Antibody |
20-abx007072 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
P21 Activated Kinase 6 (PAK6) Antibody |
20-abx008094 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
P21 Activated Kinase 6 (PAK6) Antibody |
abx026628-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
P21 Activated Kinase 6 (PAK6) Antibody |
abx026628-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
P21 Activated Kinase 6 (PAK6) Antibody |
20-abx003695 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
P21 Activated Kinase 6 (PAK6) Antibody |
20-abx212643 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PAK6 Rabbit Polyclonal Antibody