NR2C1 Rabbit Polyclonal Antibody
NR2C1 Polyclonal Antibody |
42274-100ul |
SAB |
100ul |
EUR 333 |
NR2C1 Rabbit pAb |
A6675-100ul |
Abclonal |
100 ul |
EUR 308 |
NR2C1 Rabbit pAb |
A6675-200ul |
Abclonal |
200 ul |
EUR 459 |
NR2C1 Rabbit pAb |
A6675-20ul |
Abclonal |
20 ul |
EUR 183 |
NR2C1 Rabbit pAb |
A6675-50ul |
Abclonal |
50 ul |
EUR 223 |
NR2C1 Polyclonal Conjugated Antibody |
C42274 |
SAB |
100ul |
EUR 397 |
NR2C1 antibody |
10R-1525 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal NR2C1 antibody |
NR2C1 antibody |
20R-2871 |
Fitzgerald |
100 ul |
EUR 349 |
Description: Rabbit polyclonal NR2C1 antibody |
NR2C1 antibody |
70R-18952 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NR2C1 antibody |
NR2C1 Antibody |
DF8785 |
Affbiotech |
200ul |
EUR 304 |
Description: NR2C1 Antibody detects endogenous levels of total NR2C1. |
NR2C1 Antibody |
1-CSB-PA016051ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against NR2C1. Recognizes NR2C1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
NR2C1 Antibody |
1-CSB-PA016051ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against NR2C1. Recognizes NR2C1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NR2C1 Antibody |
1-CSB-PA016051GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NR2C1. Recognizes NR2C1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
anti- NR2C1 antibody |
FNab05840 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: nuclear receptor subfamily 2, group C, member 1
- Uniprot ID: P13056
- Gene ID: 7181
- Research Area: Signal Transduction, Metabolism, Developmental biology
|
Description: Antibody raised against NR2C1 |
Anti-NR2C1 antibody |
STJ28758 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a nuclear hormone receptor characterized by a highly conserved DNA binding domain (DBD), a variable hinge region, and a carboxy-terminal ligand binding domain (LBD) that is typical for all members of the steroid/thyroid hormone receptor superfamily. This protein also belongs to a large family of ligand-inducible transcription factors that regulate gene expression by binding to specific DNA sequences within promoters of target genes. Multiple alternatively spliced transcript variants have been described, but the full-length nature of some of these variants has not been determined. |
Anti-NR2C1 antibody |
STJ190193 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NR2C1 |
NR2C1 siRNA |
20-abx903646 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR2C1 siRNA |
20-abx926331 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR2C1 siRNA |
20-abx926332 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR2C1 cloning plasmid |
CSB-CL016051HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1404
- Sequence: atggcaaccatagaagaaattgcacatcaaattattgaacaacagatgggagagattgttacagagcagcaaactgggcagaaaatccagattgtgacagcacttgatcataatacccaaggcaagcagttcattctgacaaatcacgacggctctactccaagcaaagtcattc
- Show more
|
Description: A cloning plasmid for the NR2C1 gene. |
NR2C1 Blocking Peptide |
DF8785-BP |
Affbiotech |
1mg |
EUR 195 |
Rat NR2C1 shRNA Plasmid |
20-abx988029 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NR2C1 shRNA Plasmid |
20-abx954931 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse NR2C1 shRNA Plasmid |
20-abx973202 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NR2C1 Recombinant Protein (Human) |
RP021604 |
ABM |
100 ug |
Ask for price |
NR2C1 Recombinant Protein (Rat) |
RP214454 |
ABM |
100 ug |
Ask for price |
NR2C1 Recombinant Protein (Mouse) |
RP154889 |
ABM |
100 ug |
Ask for price |
NR2C1 ORF Vector (Human) (pORF) |
ORF007202 |
ABM |
1.0 ug DNA |
EUR 95 |
Nr2c1 ORF Vector (Rat) (pORF) |
ORF071486 |
ABM |
1.0 ug DNA |
EUR 506 |
Nr2c1 ORF Vector (Mouse) (pORF) |
ORF051631 |
ABM |
1.0 ug DNA |
EUR 506 |
NR2C1 sgRNA CRISPR Lentivector set (Human) |
K1452101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nr2c1 sgRNA CRISPR Lentivector set (Mouse) |
K3814201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nr2c1 sgRNA CRISPR Lentivector set (Rat) |
K7368101 |
ABM |
3 x 1.0 ug |
EUR 339 |
NR2C1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1452102 |
ABM |
1.0 ug DNA |
EUR 154 |
NR2C1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1452103 |
ABM |
1.0 ug DNA |
EUR 154 |
NR2C1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1452104 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3814202 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3814203 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3814204 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7368102 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7368103 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7368104 |
ABM |
1.0 ug DNA |
EUR 154 |
NR2C1 Protein Vector (Human) (pPB-C-His) |
PV028805 |
ABM |
500 ng |
EUR 329 |
NR2C1 Protein Vector (Human) (pPB-N-His) |
PV028806 |
ABM |
500 ng |
EUR 329 |
NR2C1 Protein Vector (Human) (pPM-C-HA) |
PV028807 |
ABM |
500 ng |
EUR 329 |
NR2C1 Protein Vector (Human) (pPM-C-His) |
PV028808 |
ABM |
500 ng |
EUR 329 |
NR2C1 Protein Vector (Mouse) (pPB-C-His) |
PV206522 |
ABM |
500 ng |
EUR 603 |
NR2C1 Protein Vector (Mouse) (pPB-N-His) |
PV206523 |
ABM |
500 ng |
EUR 603 |
NR2C1 Protein Vector (Mouse) (pPM-C-HA) |
PV206524 |
ABM |
500 ng |
EUR 603 |
NR2C1 Protein Vector (Mouse) (pPM-C-His) |
PV206525 |
ABM |
500 ng |
EUR 603 |
NR2C1 Protein Vector (Rat) (pPB-C-His) |
PV285942 |
ABM |
500 ng |
EUR 603 |
NR2C1 Protein Vector (Rat) (pPB-N-His) |
PV285943 |
ABM |
500 ng |
EUR 603 |
NR2C1 Protein Vector (Rat) (pPM-C-HA) |
PV285944 |
ABM |
500 ng |
EUR 603 |
NR2C1 Protein Vector (Rat) (pPM-C-His) |
PV285945 |
ABM |
500 ng |
EUR 603 |
Nr2c1 3'UTR GFP Stable Cell Line |
TU164293 |
ABM |
1.0 ml |
Ask for price |
NR2C1 3'UTR Luciferase Stable Cell Line |
TU015939 |
ABM |
1.0 ml |
EUR 1521 |
Nr2c1 3'UTR Luciferase Stable Cell Line |
TU114293 |
ABM |
1.0 ml |
Ask for price |
NR2C1 3'UTR GFP Stable Cell Line |
TU065939 |
ABM |
1.0 ml |
EUR 1521 |
Nr2c1 3'UTR GFP Stable Cell Line |
TU264163 |
ABM |
1.0 ml |
Ask for price |
Nr2c1 3'UTR Luciferase Stable Cell Line |
TU214163 |
ABM |
1.0 ml |
Ask for price |
Nuclear Receptor Subfamily 2, Group C, Member 1 (NR2C1) Antibody |
20-abx114195 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
abx122665-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
20-abx142106 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
20-abx006832 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
abx028626-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
abx028626-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
20-abx320065 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
20-abx321546 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
abx235840-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
NR2C1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV666865 |
ABM |
1.0 ug DNA |
EUR 682 |
NR2C1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV666869 |
ABM |
1.0 ug DNA |
EUR 682 |
NR2C1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV666870 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NR2C1 Rabbit Polyclonal Antibody