NMUR2 Rabbit Polyclonal Antibody
NMUR2 Polyclonal Antibody |
ABP59482-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NMUR2 protein at amino acid sequence of 1-50
- Applications tips:
|
Description: A polyclonal antibody for detection of NMUR2 from Human. This NMUR2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NMUR2 protein at amino acid sequence of 1-50 |
NMUR2 Polyclonal Antibody |
46916-100ul |
SAB |
100ul |
EUR 252 |
NMUR2 Polyclonal Antibody |
46916-50ul |
SAB |
50ul |
EUR 187 |
NMUR2 Rabbit pAb |
A12812-100ul |
Abclonal |
100 ul |
EUR 308 |
NMUR2 Rabbit pAb |
A12812-200ul |
Abclonal |
200 ul |
EUR 459 |
NMUR2 Rabbit pAb |
A12812-20ul |
Abclonal |
20 ul |
EUR 183 |
NMUR2 Rabbit pAb |
A12812-50ul |
Abclonal |
50 ul |
EUR 223 |
NMUR2 Polyclonal Conjugated Antibody |
C46916 |
SAB |
100ul |
EUR 397 |
NMUR2 antibody |
70R-5107 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NMUR2 antibody raised against the N terminal of NMUR2 |
NMUR2 Antibody |
44978-100ul |
SAB |
100ul |
EUR 252 |
NMUR2 Antibody |
44978-50ul |
SAB |
50ul |
EUR 187 |
NMUR2 antibody |
20R-NR014 |
Fitzgerald |
50 ug |
EUR 656 |
Description: Rabbit polyclonal NMUR2 antibody |
NMUR2 antibody |
70R-1539 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal NMUR2 antibody raised against the N terminal of NMUR2 |
NMUR2 Antibody |
DF2821 |
Affbiotech |
200ul |
EUR 304 |
Description: NMUR2 antibody detects endogenous levels of total NMUR2. |
NMUR2 Antibody |
1-CSB-PA135689 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against NMUR2. Recognizes NMUR2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
Polyclonal NMUR2 Antibody (N-Terminus) |
AMM06736G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NMUR2 (N-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal NMUR2 antibody - N-terminal region |
AMM06737G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NMUR2 - N-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal NMUR2 antibody - N-terminal region |
AMM06738G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NMUR2 - N-terminal region. This antibody is tested and proven to work in the following applications: |
NMUR2 Conjugated Antibody |
C44978 |
SAB |
100ul |
EUR 397 |
Anti-NMUR2 antibody |
STJ99340 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to NMUR2. |
Anti-NMUR2 antibody |
STJ114678 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein from the G-protein coupled receptor 1 family. This protein is a receptor for neuromedin U, which is a neuropeptide that is widely distributed in the gut and central nervous system. This receptor plays an important role in the regulation of food intake and body weight. |
NMUR2 siRNA |
20-abx903588 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NMUR2 siRNA |
20-abx926087 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NMUR2 siRNA |
20-abx926088 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NMUR2 Blocking Peptide |
33R-6432 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NMUR2 antibody, catalog no. 70R-1539 |
NMUR2 cloning plasmid |
CSB-CL875632HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1248
- Sequence: atgtcagggatggaaaaacttcagaatgcttcctggatctaccagcagaaactagaagatccattccagaaacacctgaacagcaccgaggagtatctggccttcctctgcggacctcggcgcagccacttcttcctccccgtgtctgtggtgtatgtgccaatttttgtggtgg
- Show more
|
Description: A cloning plasmid for the NMUR2 gene. |
NMUR2 cloning plasmid |
CSB-CL875632HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1248
- Sequence: atgtcagggatggaaaaacttcagaatgcttcctggatctaccagcagaaactagaagatccattccagaaacacctgaacagcaccgaggagtatctggccttcctctgcggacctcggcgcagccacttcttcctccccgtgtctgtggtgtatgtgccaatttttgtggtgg
- Show more
|
Description: A cloning plasmid for the NMUR2 gene. |
NMUR2 Blocking Peptide |
DF2821-BP |
Affbiotech |
1mg |
EUR 195 |
Mouse NMUR2 shRNA Plasmid |
20-abx981024 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat NMUR2 shRNA Plasmid |
20-abx986147 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NMUR2 shRNA Plasmid |
20-abx961225 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NMUR2 Recombinant Protein (Human) |
RP021391 |
ABM |
100 ug |
Ask for price |
NMUR2 Recombinant Protein (Human) |
RP021394 |
ABM |
100 ug |
Ask for price |
NMUR2 Recombinant Protein (Rat) |
RP214145 |
ABM |
100 ug |
Ask for price |
NMUR2 Recombinant Protein (Mouse) |
RP154454 |
ABM |
100 ug |
Ask for price |
Neuromedin U Receptor 2 (NMUR2) Antibody |
20-abx147557 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuromedin U Receptor 2 (NMUR2) Antibody |
20-abx324995 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rabbit Anti-Human NMU receptor 2 (NMUR2) antiserum # 1 |
NMUR21-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
Rabbit Anti-Rat NMU receptor 2 (NMUR2) antiserum #2 |
NMUR22-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
NMUR2 ORF Vector (Human) (pORF) |
ORF007131 |
ABM |
1.0 ug DNA |
EUR 95 |
NMUR2 ORF Vector (Human) (pORF) |
ORF007132 |
ABM |
1.0 ug DNA |
EUR 95 |
Nmur2 ORF Vector (Rat) (pORF) |
ORF071383 |
ABM |
1.0 ug DNA |
EUR 506 |
Nmur2 ORF Vector (Mouse) (pORF) |
ORF051486 |
ABM |
1.0 ug DNA |
EUR 506 |
Rabbit Anti-Human NMU receptor 2 (NMUR2) IgG # 1, aff pure |
NMUR21-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
Rabbit Anti-Rat NMU receptor 2 (NMUR2) IgG # 2, aff pure |
NMUR22-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
NMUR2 sgRNA CRISPR Lentivector set (Human) |
K1437501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nmur2 sgRNA CRISPR Lentivector set (Mouse) |
K3599401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nmur2 sgRNA CRISPR Lentivector set (Rat) |
K7097301 |
ABM |
3 x 1.0 ug |
EUR 339 |
NMUR2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1437502 |
ABM |
1.0 ug DNA |
EUR 154 |
NMUR2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1437503 |
ABM |
1.0 ug DNA |
EUR 154 |
NMUR2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1437504 |
ABM |
1.0 ug DNA |
EUR 154 |
Nmur2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3599402 |
ABM |
1.0 ug DNA |
EUR 154 |
Nmur2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3599403 |
ABM |
1.0 ug DNA |
EUR 154 |
Nmur2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3599404 |
ABM |
1.0 ug DNA |
EUR 154 |
Nmur2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7097302 |
ABM |
1.0 ug DNA |
EUR 154 |
Nmur2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7097303 |
ABM |
1.0 ug DNA |
EUR 154 |
Nmur2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7097304 |
ABM |
1.0 ug DNA |
EUR 154 |
NMUR2 Protein Vector (Human) (pPB-C-His) |
PV028521 |
ABM |
500 ng |
EUR 329 |
NMUR2 Protein Vector (Human) (pPB-N-His) |
PV028522 |
ABM |
500 ng |
EUR 329 |
NMUR2 Protein Vector (Human) (pPM-C-HA) |
PV028523 |
ABM |
500 ng |
EUR 329 |
NMUR2 Protein Vector (Human) (pPM-C-His) |
PV028524 |
ABM |
500 ng |
EUR 329 |
NMUR2 Protein Vector (Human) (pPB-C-His) |
PV028525 |
ABM |
500 ng |
EUR 329 |
NMUR2 Protein Vector (Human) (pPB-N-His) |
PV028526 |
ABM |
500 ng |
EUR 329 |
NMUR2 Protein Vector (Human) (pPM-C-HA) |
PV028527 |
ABM |
500 ng |
EUR 329 |
NMUR2 Protein Vector (Human) (pPM-C-His) |
PV028528 |
ABM |
500 ng |
EUR 329 |
NMUR2 Protein Vector (Mouse) (pPB-C-His) |
PV205942 |
ABM |
500 ng |
EUR 603 |
NMUR2 Protein Vector (Mouse) (pPB-N-His) |
PV205943 |
ABM |
500 ng |
EUR 603 |
NMUR2 Protein Vector (Mouse) (pPM-C-HA) |
PV205944 |
ABM |
500 ng |
EUR 603 |
NMUR2 Protein Vector (Mouse) (pPM-C-His) |
PV205945 |
ABM |
500 ng |
EUR 603 |
NMUR2 Protein Vector (Rat) (pPB-C-His) |
PV285530 |
ABM |
500 ng |
EUR 603 |
NMUR2 Protein Vector (Rat) (pPB-N-His) |
PV285531 |
ABM |
500 ng |
EUR 603 |
NMUR2 Protein Vector (Rat) (pPM-C-HA) |
PV285532 |
ABM |
500 ng |
EUR 603 |
NMUR2 Protein Vector (Rat) (pPM-C-His) |
PV285533 |
ABM |
500 ng |
EUR 603 |
Nmur2 3'UTR GFP Stable Cell Line |
TU164181 |
ABM |
1.0 ml |
Ask for price |
NMUR2 3'UTR Luciferase Stable Cell Line |
TU015790 |
ABM |
1.0 ml |
EUR 1394 |
Nmur2 3'UTR Luciferase Stable Cell Line |
TU114181 |
ABM |
1.0 ml |
Ask for price |
NMUR2 Rabbit Polyclonal Antibody