NDEL1 Rabbit Polyclonal Antibody

NDEL1 Rabbit Polyclonal Antibody

 

NDEL1 Polyclonal Antibody
ABP59415-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NDEL1 protein at amino acid sequence of 160-240 Applications tips:
Description: A polyclonal antibody for detection of NDEL1 from Human, Mouse, Rat. This NDEL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDEL1 protein at amino acid sequence of 160-240

NDEL1 Polyclonal Antibody
ES9004-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NDEL1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NDEL1 Polyclonal Antibody
ES9004-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NDEL1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NDEL1 Rabbit pAb
A5776-100ul	Abclonal	100 ul	EUR 308

NDEL1 Rabbit pAb
A5776-200ul	Abclonal	200 ul	EUR 459

NDEL1 Rabbit pAb
A5776-20ul	Abclonal	20 ul	EUR 183

NDEL1 Rabbit pAb
A5776-50ul	Abclonal	50 ul	EUR 223

Polyclonal NDEL1 Antibody (Center)
AMM06578G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NDEL1 (Center). This antibody is tested and proven to work in the following applications:

NDEL1 antibody
70R-18793	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NDEL1 antibody

NDEL1 Antibody
33038-100ul	SAB	100ul	EUR 252

NDEL1 antibody
10R-4928	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal NDEL1 antibody

NDEL1 antibody
10R-4929	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal NDEL1 antibody

NDEL1 antibody
10R-4930	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal NDEL1 antibody

NDEL1 antibody
10R-4931	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal NDEL1 antibody

NDEL1 antibody
10R-4932	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal NDEL1 antibody

NDEL1 antibody
10R-4933	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal NDEL1 antibody

NDEL1 Antibody
1-CSB-PA967640	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NDEL1. Recognizes NDEL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

NDEL1 Antibody
1-CSB-PA872414ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NDEL1. Recognizes NDEL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

NDEL1 Antibody
1-CSB-PA015603GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NDEL1. Recognizes NDEL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NDEL1 Antibody
AF7025	Affbiotech	200ul	EUR 376
Description: NDEL1 Antibody detects endogenous levels of NDEL1 .

Polyclonal Goat Anti-NDEL1 Antibody
APR12128G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-NDEL1 . This antibody is tested and proven to work in the following applications:

NDEL1 (Phospho-Thr219) Polyclonal Conjugated Antibody
C12766	SAB	100ul	EUR 397

Ndel1/ Rat Ndel1 ELISA Kit
ELI-38373r	Lifescience Market	96 Tests	EUR 886

NDEL1 (pT219) Antibody
abx217078-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

NDEL1 Conjugated Antibody
C33038	SAB	100ul	EUR 397

anti- NDEL1 antibody
FNab05601	FN Test	100µg	EUR 505.25
Immunogen: nudE nuclear distribution gene E homolog(A. nidulans)-like 1 Uniprot ID: Q9GZM8 Gene ID: 81565 Research Area: Neuroscience, Cell Division and Proliferation, Developmental biology
Description: Antibody raised against NDEL1

Anti-NDEL1 antibody
PAab05601	Lifescience Market	100 ug	EUR 355

Anti-NDEL1 antibody
STJ28343	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a coiled-coil protein that plays a role in multiple processes including cytoskeletal organization, cell signaling and neuron migration, outgrowth and maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome X.

Anti-NDEL1 antibody
STJ71835	St John's Laboratory	100 µg	EUR 359

Anti-NDEL1 antibody
STJ190162	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NDEL1

NDEL1 siRNA
20-abx903498	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NDEL1 siRNA
20-abx925549	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NDEL1 siRNA
20-abx925550	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NDEL1 (Phospho-Thr219) Antibody
12766-100ul	SAB	100ul	EUR 252

NDEL1 (Phospho-Thr219) Antibody
12766-50ul	SAB	50ul	EUR 187

Phospho-NDEL1 (Thr219) Antibody
AF8492	Affbiotech	200ul	EUR 376
Description: NDEL1 (Phospho-Thr219) Antibody detects endogenous levels of NDEL1 only when phosphorylated at Thr219.

NDEL1 (Phospho- Thr219) Antibody
ABF8492	Lifescience Market	100 ug	EUR 438

NDEL1 Blocking Peptide
AF7025-BP	Affbiotech	1mg	EUR 195

NDEL1 cloning plasmid
CSB-CL872414HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1038 Sequence: atggatggtgaagatataccagatttttcaagtttaaaggaggaaactgcttattggaaggaactttccttgaagtataagcaaagcttccaggaagctcgggatgagctagttgaattccaggaaggaagcagagaattagaagcagagttggaggcacaattagtacaggctg Show more
Description: A cloning plasmid for the NDEL1 gene.

NDEL1 protein (His tag)
80R-3923	Fitzgerald	50 ug	EUR 435
Description: Purified recombinant NDEL1 protein (His tag)

Chicken NDEL1 ELISA KIT
ELI-20675c	Lifescience Market	96 Tests	EUR 928

NDEL1 ELISA KIT|Human
EF001123	Lifescience Market	96 Tests	EUR 689

Rat NDEL1 shRNA Plasmid
20-abx987618	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse NDEL1 shRNA Plasmid
20-abx979123	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NDEL1 shRNA Plasmid
20-abx963000	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NDEL1 Recombinant Protein (Human)
RP020881	ABM	100 ug	Ask for price

NDEL1 Recombinant Protein (Mouse)
RP153371	ABM	100 ug	Ask for price

NDEL1 Recombinant Protein (Rat)
RP213443	ABM	100 ug	Ask for price

Phospho-NDEL1 (Thr219) Blocking Peptide
AF8492-BP	Affbiotech	1mg	EUR 195

Ndel1 ORF Vector (Rat) (pORF)
ORF071149	ABM	1.0 ug DNA	EUR 506

NDEL1 ORF Vector (Human) (pORF)
ORF006961	ABM	1.0 ug DNA	EUR 95

Ndel1 ORF Vector (Mouse) (pORF)
ORF051125	ABM	1.0 ug DNA	EUR 506

Rabbit Nuclear distribution protein nudE- like 1, NDEL1 ELISA KI
ELI-36714Ra	Lifescience Market	96 Tests	EUR 928

NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody
20-abx004424	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

NudE Neurodevelopment Protein 1 Like 1 (Ndel1) Antibody
20-abx114242	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody
20-abx241576	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody
abx235601-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody
20-abx321714	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody
abx432229-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody
20-abx225310	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Ndel1 sgRNA CRISPR Lentivector set (Rat)
K7045001	ABM	3 x 1.0 ug	EUR 339

NDEL1 sgRNA CRISPR Lentivector set (Human)
K1406501	ABM	3 x 1.0 ug	EUR 339

Ndel1 sgRNA CRISPR Lentivector set (Mouse)
K4726801	ABM	3 x 1.0 ug	EUR 339

Ndel1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7045002	ABM	1.0 ug DNA	EUR 154

Ndel1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7045003	ABM	1.0 ug DNA	EUR 154

Ndel1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7045004	ABM	1.0 ug DNA	EUR 154

NDEL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1406502	ABM	1.0 ug DNA	EUR 154

NDEL1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1406503	ABM	1.0 ug DNA	EUR 154

NDEL1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1406504	ABM	1.0 ug DNA	EUR 154

Ndel1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4726802	ABM	1.0 ug DNA	EUR 154

Ndel1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4726803	ABM	1.0 ug DNA	EUR 154

Ndel1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4726804	ABM	1.0 ug DNA	EUR 154

NDEL1 Protein Vector (Mouse) (pPB-C-His)
PV204498	ABM	500 ng	EUR 603

NDEL1 Protein Vector (Mouse) (pPB-N-His)
PV204499	ABM	500 ng	EUR 603

NDEL1 Protein Vector (Mouse) (pPM-C-HA)
PV204500	ABM	500 ng	EUR 603

NDEL1 Protein Vector (Mouse) (pPM-C-His)
PV204501	ABM	500 ng	EUR 603

NDEL1 Protein Vector (Rat) (pPB-C-His)
PV284594	ABM	500 ng	EUR 603

NDEL1 Protein Vector (Rat) (pPB-N-His)
PV284595	ABM	500 ng	EUR 603

NDEL1 Protein Vector (Rat) (pPM-C-HA)
PV284596	ABM	500 ng	EUR 603

NDEL1 Protein Vector (Rat) (pPM-C-His)
PV284597	ABM	500 ng	EUR 603

NDEL1 Protein Vector (Human) (pPB-C-His)
PV027841	ABM	500 ng	EUR 329

NDEL1 Protein Vector (Human) (pPB-N-His)
PV027842	ABM	500 ng	EUR 329

NDEL1 Protein Vector (Human) (pPM-C-HA)
PV027843	ABM	500 ng	EUR 329

NDEL1 Protein Vector (Human) (pPM-C-His)
PV027844	ABM	500 ng	EUR 329

Ndel1 3'UTR Luciferase Stable Cell Line
TU113908	ABM	1.0 ml	Ask for price

Ndel1 3'UTR GFP Stable Cell Line
TU163908	ABM	1.0 ml	Ask for price

 

NDEL1 Rabbit Polyclonal Antibody