MAST1 Rabbit Polyclonal Antibody

MAST1 Rabbit Polyclonal Antibody


MAST1 Polyclonal Antibody

ES9107-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MAST1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MAST1 Polyclonal Antibody

ES9107-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MAST1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MAST1 antibody

70R-18419 50 ul
EUR 435
Description: Rabbit polyclonal MAST1 antibody

MAST1 Antibody

45569-100ul 100ul
EUR 252

MAST1 Antibody

45569-50ul 50ul
EUR 187

MAST1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAST1. Recognizes MAST1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MAST1 Antibody

DF8892 200ul
EUR 304
Description: MAST1 Antibody detects endogenous levels of total MAST1.

MAST1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MAST1. Recognizes MAST1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MAST1 Antibody

ABD8892 100 ug
EUR 438

Polyclonal Mouse Mast1 Antibody (C-term)

APR17430G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Mast1 (C-term). This antibody is tested and proven to work in the following applications:

Mast1/ Rat Mast1 ELISA Kit

ELI-16331r 96 Tests
EUR 886

Mouse Mast1 Antibody

abx034670-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Mast1 Antibody

abx034670-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MAST1 Conjugated Antibody

C45569 100ul
EUR 397

anti- MAST1 antibody

FNab05024 100µg
EUR 505.25
  • Immunogen: microtubule associated serine/threonine kinase 1
  • Uniprot ID: Q9Y2H9
  • Gene ID: 22983
  • Research Area: Metabolism
Description: Antibody raised against MAST1

Anti-MAST1 antibody

PAab05024 100 ug
EUR 355

Anti-MAST1 antibody

STJ190265 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MAST1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MAST1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAST1. Recognizes MAST1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MAST1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAST1. Recognizes MAST1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MAST1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAST1. Recognizes MAST1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MAST1 cloning plasmid

CSB-CL897529HU-10ug 10ug
EUR 1141
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3192
  • Sequence: atgggtcacatcaagctcacagatttcggcctctccaagatggggctcatgagcctcaccaccaacttatatgaaggccacatcgagaaggacgcccgagagttcctggacaaacaggtgtgtgggaccccagagtacatcgcgcccgaggtcatcctgcgtcaaggctacggca
  • Show more
Description: A cloning plasmid for the MAST1 gene.

MAST1 Blocking Peptide

DF8892-BP 1mg
EUR 195


ELI-08438h 96 Tests
EUR 824


EF010848 96 Tests
EUR 689

Rat MAST1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MAST1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MAST1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Mast1 ELISA KIT

ELI-39128m 96 Tests
EUR 865

MAST1 ORF Vector (Rat) (pORF)

ORF070313 1.0 ug DNA
EUR 2080

MAST1 ORF Vector (Human) (pORF)

ORF006288 1.0 ug DNA
EUR 95

Mast1 ORF Vector (Mouse) (pORF)

ORF049850 1.0 ug DNA
EUR 1572

Microtubule Associated Serine/Threonine Kinase 1 (MAST1) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microtubule Associated Serine/Threonine Kinase 1 (MAST1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Microtubule Associated Serine/Threonine Kinase 1 (MAST1) Antibody

abx235024-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Microtubule Associated Serine/Threonine Kinase 1 (MAST1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MAST1 sgRNA CRISPR Lentivector set (Rat)

K7257701 3 x 1.0 ug
EUR 339

Mast1 sgRNA CRISPR Lentivector set (Mouse)

K3152301 3 x 1.0 ug
EUR 339

MAST1 sgRNA CRISPR Lentivector set (Human)

K1272201 3 x 1.0 ug
EUR 339


MAST1 Rabbit Polyclonal Antibody