LSM1 Rabbit Polyclonal Antibody
LSM1 Polyclonal Antibody |
ABP59155-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LSM1 protein at amino acid sequence of 50-130
- Applications tips:
|
Description: A polyclonal antibody for detection of LSM1 from Human, Mouse. This LSM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LSM1 protein at amino acid sequence of 50-130 |
LSM1 Polyclonal Antibody |
A62902 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
LSM1 Rabbit pAb |
A12732-100ul |
Abclonal |
100 ul |
EUR 308 |
LSM1 Rabbit pAb |
A12732-200ul |
Abclonal |
200 ul |
EUR 459 |
LSM1 Rabbit pAb |
A12732-20ul |
Abclonal |
20 ul |
EUR 183 |
LSM1 Rabbit pAb |
A12732-50ul |
Abclonal |
50 ul |
EUR 223 |
LSM1 Rabbit pAb |
A5976-100ul |
Abclonal |
100 ul |
EUR 308 |
LSM1 Rabbit pAb |
A5976-200ul |
Abclonal |
200 ul |
EUR 459 |
LSM1 Rabbit pAb |
A5976-20ul |
Abclonal |
20 ul |
Ask for price |
LSM1 Rabbit pAb |
A5976-50ul |
Abclonal |
50 ul |
Ask for price |
LSM1 antibody |
70R-4947 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal LSM1 antibody |
LSM1 antibody |
70R-51377 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal LSM1 antibody |
LSM1 Antibody |
45470-100ul |
SAB |
100ul |
EUR 252 |
LSM1 Antibody |
45470-50ul |
SAB |
50ul |
EUR 187 |
LSM1 antibody |
10R-4716 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal LSM1 antibody |
LSM1 antibody |
10R-4718 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal LSM1 antibody |
LSM1 antibody |
10R-4719 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal LSM1 antibody |
LSM1 antibody |
70R-18318 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal LSM1 antibody |
LSM1 Antibody |
DF8754 |
Affbiotech |
200ul |
EUR 304 |
Description: LSM1 Antibody detects endogenous levels of total LSM1. |
LSM1 Antibody |
1-CSB-PA013199GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against LSM1. Recognizes LSM1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
LSM1 Antibody |
1-CSB-PA013199LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LSM1. Recognizes LSM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
LSM1 Polyclonal Antibody, HRP Conjugated |
A62903 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
LSM1 Polyclonal Antibody, FITC Conjugated |
A62904 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
LSM1 Polyclonal Antibody, Biotin Conjugated |
A62905 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody |
20-abx113534 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody |
abx145171-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody |
20-abx148920 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody |
20-abx007781 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody |
20-abx004587 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody |
abx031756-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody |
abx031756-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody |
abx031757-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody |
abx031757-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody |
abx234870-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody |
20-abx304385 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
LSM1 Conjugated Antibody |
C45470 |
SAB |
100ul |
EUR 397 |
anti- LSM1 antibody |
FNab04870 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: LSM1 homolog, U6 small nuclear RNA associated(S. cerevisiae)
- Uniprot ID: O15116
- Gene ID: 27257
- Research Area: Metabolism
|
Description: Antibody raised against LSM1 |
Human LSM1 Antibody |
33168-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-LSM1 antibody |
STJ27772 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the LSm family of RNA-binding proteins. LSm proteins form stable heteromers that bind specifically to the 3'-terminal oligo(U) tract of U6 snRNA and may play a role in pre-mRNA splicing by mediating U4/U6 snRNP formation. Increased expression of this gene may play a role in cellular transformation and the progression of several malignancies including lung cancer, mesothelioma and breast cancer. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. |
Anti-LSM1 antibody |
STJ114605 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the LSm family of RNA-binding proteins. LSm proteins form stable heteromers that bind specifically to the 3'-terminal oligo(U) tract of U6 snRNA and may play a role in pre-mRNA splicing by mediating U4/U6 snRNP formation. Increased expression of this gene may play a role in cellular transformation and the progression of several malignancies including lung cancer, mesothelioma and breast cancer. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. |
Anti-LSM1 antibody |
STJ190180 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LSM1 |
LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody (HRP) |
20-abx304386 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody (FITC) |
20-abx304387 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody (Biotin) |
20-abx304388 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
LSM1 siRNA |
20-abx923052 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LSM1 siRNA |
20-abx923053 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-LSM1 |
YF-PA18443 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to LSM1 |
LSM1 Antibody, HRP conjugated |
1-CSB-PA013199LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LSM1. Recognizes LSM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
LSM1 Antibody, FITC conjugated |
1-CSB-PA013199LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LSM1. Recognizes LSM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
LSM1 Antibody, Biotin conjugated |
1-CSB-PA013199LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LSM1. Recognizes LSM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
LSM1 Homolog, mRNA Degradation Associated (LSM1) Protein |
20-abx261389 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
LSM1 cloning plasmid |
CSB-CL013199HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 402
- Sequence: atgaactatatgcctggcaccgccagcctcatcgaggacattgacaaaaagcacttggttctgcttcgagatggaaggacacttataggctttttaagaagcattgatcaatttgcaaacttagtgctacatcagactgtggagcgtattcatgtgggcaaaaaatacggtgatat
- Show more
|
Description: A cloning plasmid for the LSM1 gene. |
LSM1 Blocking Peptide |
20-abx064252 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LSM1 Blocking Peptide |
33R-8375 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LSM1 antibody, catalog no. 70R-4947 |
LSM1 Blocking Peptide |
DF8754-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-LSM1 (4F7) |
YF-MA18190 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to LSM1 |
Human LSM1 Antibody (Biotin Conjugate) |
33168-05121 |
AssayPro |
150 ug |
EUR 369 |
Human LSM1 Homolog, mRNA Degradation Associated (LSM1) ELISA Kit |
abx388331-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human LSM1 AssayLite Antibody (FITC Conjugate) |
33168-05141 |
AssayPro |
150 ug |
EUR 428 |
Human LSM1 AssayLite Antibody (RPE Conjugate) |
33168-05151 |
AssayPro |
150 ug |
EUR 428 |
Human LSM1 AssayLite Antibody (APC Conjugate) |
33168-05161 |
AssayPro |
150 ug |
EUR 428 |
Human LSM1 AssayLite Antibody (PerCP Conjugate) |
33168-05171 |
AssayPro |
150 ug |
EUR 471 |
Mouse LSM1 shRNA Plasmid |
20-abx976033 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human LSM1 shRNA Plasmid |
20-abx959048 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LSM1 protein (His tag) |
80R-1496 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant Human LSM1 protein |
LSM1 Recombinant Protein (Human) |
RP018349 |
ABM |
100 ug |
Ask for price |
LSM1 Recombinant Protein (Rat) |
RP210182 |
ABM |
100 ug |
Ask for price |
LSM1 Recombinant Protein (Mouse) |
RP148475 |
ABM |
100 ug |
Ask for price |
Mouse U6 snRNA- associated Sm- like protein LSm1, Lsm1 ELISA KIT |
ELI-19541m |
Lifescience Market |
96 Tests |
EUR 865 |
Human U6 snRNA- associated Sm- like protein LSm1, LSM1 ELISA KIT |
ELI-27772h |
Lifescience Market |
96 Tests |
EUR 824 |
Recombinant Human U6 snRNA-Associated Sm-Like Protein LSm1/LSM1 (C-6His) |
C262-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human U6 snRNA-Associated Sm-Like Protein LSm1/LSM1 (C-6His) |
C262-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human U6 snRNA-Associated Sm-Like Protein LSm1/LSM1 (C-6His) |
C262-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human U6 snRNA-Associated Sm-Like Protein LSm1/LSM1 (C-6His) |
C262-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
LSM1 ORF Vector (Human) (pORF) |
ORF006117 |
ABM |
1.0 ug DNA |
EUR 95 |
Lsm1 ORF Vector (Mouse) (pORF) |
ORF049493 |
ABM |
1.0 ug DNA |
EUR 506 |
Lsm1 ORF Vector (Rat) (pORF) |
ORF070062 |
ABM |
1.0 ug DNA |
EUR 506 |
LSM1 sgRNA CRISPR Lentivector set (Human) |
K1240701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lsm1 sgRNA CRISPR Lentivector set (Rat) |
K6324001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lsm1 sgRNA CRISPR Lentivector set (Mouse) |
K4940901 |
ABM |
3 x 1.0 ug |
EUR 339 |
LSM1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1240702 |
ABM |
1.0 ug DNA |
EUR 154 |
LSM1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1240703 |
ABM |
1.0 ug DNA |
EUR 154 |
LSM1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1240704 |
ABM |
1.0 ug DNA |
EUR 154 |
Lsm1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6324002 |
ABM |
1.0 ug DNA |
EUR 154 |
Lsm1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6324003 |
ABM |
1.0 ug DNA |
EUR 154 |
Lsm1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6324004 |
ABM |
1.0 ug DNA |
EUR 154 |
Lsm1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4940902 |
ABM |
1.0 ug DNA |
EUR 154 |
Lsm1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4940903 |
ABM |
1.0 ug DNA |
EUR 154 |
Lsm1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4940904 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Human LSM1 Protein, His, E.coli-1mg |
QP12589-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human LSM1 Protein, His, E.coli-20ug |
QP12589-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human LSM1 Protein, His, E.coli-5ug |
QP12589-5ug |
EnQuireBio |
5ug |
EUR 155 |
LSM1 Protein Vector (Human) (pPB-C-His) |
PV024465 |
ABM |
500 ng |
EUR 329 |
LSM1 Protein Vector (Human) (pPB-N-His) |
PV024466 |
ABM |
500 ng |
EUR 329 |
LSM1 Protein Vector (Human) (pPM-C-HA) |
PV024467 |
ABM |
500 ng |
EUR 329 |
LSM1 Protein Vector (Human) (pPM-C-His) |
PV024468 |
ABM |
500 ng |
EUR 329 |
LSM1 Protein Vector (Rat) (pPB-C-His) |
PV280246 |
ABM |
500 ng |
EUR 603 |
LSM1 Protein Vector (Rat) (pPB-N-His) |
PV280247 |
ABM |
500 ng |
EUR 603 |
LSM1 Protein Vector (Rat) (pPM-C-HA) |
PV280248 |
ABM |
500 ng |
EUR 603 |
LSM1 Protein Vector (Rat) (pPM-C-His) |
PV280249 |
ABM |
500 ng |
EUR 603 |
LSM1 Rabbit Polyclonal Antibody