LRP6 Rabbit Polyclonal Antibody
LRP6 Polyclonal Antibody |
ES8988-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against LRP6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
LRP6 Polyclonal Antibody |
ES8988-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against LRP6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
LRP6 Rabbit pAb |
A13324-100ul |
Abclonal |
100 ul |
EUR 308 |
LRP6 Rabbit pAb |
A13324-200ul |
Abclonal |
200 ul |
EUR 459 |
LRP6 Rabbit pAb |
A13324-20ul |
Abclonal |
20 ul |
EUR 183 |
LRP6 Rabbit pAb |
A13324-50ul |
Abclonal |
50 ul |
EUR 223 |
LRP6 Rabbit pAb |
A13678-100ul |
Abclonal |
100 ul |
EUR 308 |
LRP6 Rabbit pAb |
A13678-200ul |
Abclonal |
200 ul |
EUR 459 |
LRP6 Rabbit pAb |
A13678-20ul |
Abclonal |
20 ul |
EUR 183 |
LRP6 Rabbit pAb |
A13678-50ul |
Abclonal |
50 ul |
EUR 223 |
LRP6 Rabbit pAb |
A15070-100ul |
Abclonal |
100 ul |
EUR 308 |
LRP6 Rabbit pAb |
A15070-200ul |
Abclonal |
200 ul |
EUR 459 |
LRP6 Rabbit pAb |
A15070-20ul |
Abclonal |
20 ul |
EUR 183 |
LRP6 Rabbit pAb |
A15070-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal LRP6 Antibody (Internal) |
APS00034G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LRP6 (Internal). This antibody is tested and proven to work in the following applications: |
Rabbit LRP6 ELISA Kit |
ERTL0286 |
Abclonal |
96Tests |
EUR 521 |
LRP6 antibody |
38724-100ul |
SAB |
100ul |
EUR 252 |
LRP6 Antibody |
45043-100ul |
SAB |
100ul |
EUR 252 |
LRP6 Antibody |
45043-50ul |
SAB |
50ul |
EUR 187 |
LRP6 Antibody |
43398-100ul |
SAB |
100ul |
EUR 252 |
LRP6 Antibody |
DF2995 |
Affbiotech |
200ul |
EUR 304 |
Description: LRP6 Antibody detects endogenous levels of total LRP6. |
LRP6 Antibody |
DF7837 |
Affbiotech |
200ul |
EUR 304 |
Description: LRP6 Antibody detects endogenous levels of total LRP6. |
LRP6 Antibody |
1-CSB-PA234397 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against LRP6. Recognizes LRP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:40-1:200 |
LRP6 Antibody |
1-CSB-PA013102ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against LRP6. Recognizes LRP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal LRP6 Antibody (internal region) |
APS00033G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LRP6 (internal region). This antibody is tested and proven to work in the following applications: |
Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit |
DLR-LRP6-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) in samples from tissue homogenates or other biological fluids. |
Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit |
DLR-LRP6-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) in samples from tissue homogenates or other biological fluids. |
Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit |
RDR-LRP6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit |
RDR-LRP6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit |
RD-LRP6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit |
RD-LRP6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Polyclonal LRP6 Antibody (C-term T1546) |
APR14063G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LRP6 (C-term T1546). This antibody is tested and proven to work in the following applications: |
LRP6 (Phospho-Thr1479) Polyclonal Conjugated Antibody |
C12661 |
SAB |
100ul |
EUR 397 |
LRP6 (Phospho-Ser1490) Polyclonal Conjugated Antibody |
C12809 |
SAB |
100ul |
EUR 397 |
LRP6 (pT1479) Antibody |
abx216611-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
LRP6 (pS1490) Antibody |
20-abx216612 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LRP6 Conjugated Antibody |
C45043 |
SAB |
100ul |
EUR 397 |
LRP6 Conjugated Antibody |
C38724 |
SAB |
100ul |
EUR 397 |
Anti-LRP6 antibody |
STJ27887 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined. |
Anti-LRP6 antibody |
STJ115287 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined. |
Anti-LRP6 antibody |
STJ115288 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined. |
Anti-LRP6 antibody |
STJ115633 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined. |
Anti-LRP6 antibody |
STJ117264 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined. |
Anti-LRP6 antibody |
STJ190146 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LRP6 |
LRP6 siRNA |
20-abx922854 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LRP6 siRNA |
20-abx922855 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LRP6 (Phospho-Thr1479) Antibody |
12661-100ul |
SAB |
100ul |
EUR 252 |
LRP6 (Phospho-Thr1479) Antibody |
12661-50ul |
SAB |
50ul |
EUR 187 |
LRP6 (Phospho-Ser1490) Antibody |
12809-100ul |
SAB |
100ul |
EUR 252 |
LRP6 (Phospho-Ser1490) Antibody |
12809-50ul |
SAB |
50ul |
EUR 187 |
Phospho-LRP6 (Ser1490) Antibody |
DF2994 |
Affbiotech |
200ul |
EUR 304 |
Description: Phospho-LRP6 (Ser1490) Antibody detects endogenous levels of LRP6 only when phosphorylated at Ser1490. |
Phospho-LRP6 (Ser1490) Antibody |
abx216613-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Phospho-LRP6 (Thr1479) Antibody |
AF8343 |
Affbiotech |
200ul |
EUR 376 |
Description: LRP6 (Phospho-Thr1479) Antibody detects endogenous levels of LRP6 only when phosphorylated at Thr1479. |
Phospho-LRP6 (Ser1490) Antibody |
AF8344 |
Affbiotech |
200ul |
EUR 376 |
Description: LRP6 (Phospho-Ser1490) Antibody detects endogenous levels of LRP6 only when phosphorylated at Ser1490. |
LRP6 Blocking Peptide |
DF2995-BP |
Affbiotech |
1mg |
EUR 195 |
LRP6 Blocking Peptide |
DF7837-BP |
Affbiotech |
1mg |
EUR 195 |
LRP6 cloning plasmid |
CSB-CL013102HU-10ug |
Cusabio |
10ug |
EUR 1882 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4842
- Sequence: atgggggccgtcctgaggagcctcctggcctgcagcttctgtgtgctcctgagagcggcccctttgttgctttatgcaaacagacgggacttgcgattggttgatgctacaaatggcaaagagaatgctacgattgtagttggaggcttggaggatgcagctgcggtggactttg
- Show more
|
Description: A cloning plasmid for the LRP6 gene. |
Low-density lipoprotein receptor-related protein 6 (LRP6) polyclonal antibody |
ABP-PAB-10779 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Cell Surface Molecules / GPCRs
- Brand:
|
Human LRP6 ELISA Kit |
EHL0286 |
Abclonal |
96Tests |
EUR 521 |
LRP6 Rabbit Polyclonal Antibody