ID1 Rabbit Polyclonal Antibody
ID1 Rabbit pAb |
A8432-100ul |
Abclonal |
100 ul |
EUR 308 |
ID1 Rabbit pAb |
A8432-200ul |
Abclonal |
200 ul |
EUR 459 |
ID1 Rabbit pAb |
A8432-20ul |
Abclonal |
20 ul |
EUR 183 |
ID1 Rabbit pAb |
A8432-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal ID1 Antibody (Center) |
APR03608G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ID1 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal ID1 Antibody (Center) |
APR05400G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ID1 (Center). This antibody is tested and proven to work in the following applications: |
Anti-Id1 Rabbit Monoclonal Antibody |
M00945 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Id1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat. |
ID1 antibody |
70R-17876 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ID1 antibody |
ID1 antibody |
10R-1581 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal ID1 antibody |
Id1 Antibody |
49637-100ul |
SAB |
100ul |
EUR 333 |
Id1 Antibody |
49637-50ul |
SAB |
50ul |
EUR 239 |
Id1 Antibody |
45023-100ul |
SAB |
100ul |
EUR 252 |
Id1 Antibody |
45023-50ul |
SAB |
50ul |
EUR 187 |
Id1 Antibody |
DF2932 |
Affbiotech |
200ul |
EUR 304 |
Description: Id1 Antibody detects endogenous levels of total Id1. |
ID1 antibody |
70R-49891 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal ID1 antibody |
ID1 Antibody |
1-CSB-PA010966GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ID1. Recognizes ID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Id1 Conjugated Antibody |
C49637 |
SAB |
100ul |
EUR 397 |
Id1 Conjugated Antibody |
C45023 |
SAB |
100ul |
EUR 397 |
anti- ID1 antibody |
FNab10217 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: DNA-binding protein inhibitor ID-1
- Uniprot ID: P41134
- Gene ID: 3397
|
Description: Antibody raised against ID1 |
anti- ID1 antibody |
FNab04114 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
- Uniprot ID: P41134
- Gene ID: 3397
- Research Area: Stem Cells, Cancer, Metabolism, Developmental biology
|
Description: Antibody raised against ID1 |
Anti-ID1 antibody |
STJ110730 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with members of the basic HLH family of transcription factors. The encoded protein has no DNA binding activity and therefore can inhibit the DNA binding and transcriptional activation ability of basic HLH proteins with which it interacts. This protein may play a role in cell growth, senescence, and differentiation. Two transcript variants encoding different isoforms have been found for this gene. |
Anti-ID1 antibody |
STJ190197 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ID1 |
ID1 siRNA |
20-abx920129 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ID1 siRNA |
20-abx920130 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-Id1 |
YF-PA12521 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Id1 |
Id1 recombinant monoclonal antibody |
A5540 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human Id1 for WB, IHC, IF,ELISA |
Id1 Blocking Peptide |
DF2932-BP |
Affbiotech |
1mg |
EUR 195 |
ID1 Blocking Peptide |
20-abx062766 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ID1 cloning plasmid |
CSB-CL010966HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 468
- Sequence: atgaaagtcgccagtggcagcaccgccaccgccgccgcgggccccagctgcgcgctgaaggccggcaagacagcgagcggtgcgggcgaggtggtgcgctgtctgtctgagcagagcgtggccatctcgcgctgcgccgggggcgccggggcgcgcctgcctgccctgctggacga
- Show more
|
Description: A cloning plasmid for the ID1 gene. |
Anti-Id1 (1F7) |
YF-MA10465 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Id1 |
Anti-ID1 (2E10) |
YF-MA13626 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ID1 |
Anti-ID1 (4G11) |
YF-MA13627 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ID1 |
Anti-ID1 (5D9) |
YF-MA13628 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to ID1 |
Anti-ID1 (4G7) |
YF-MA13629 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ID1 |
Anti-ID1 (1B10) |
YF-MA13630 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ID1 |
Anti-ID1 (3A9) |
YF-MA13631 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ID1 |
Anti-ID1 (2C7) |
YF-MA13632 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ID1 |
Anti-ID1 (1D9) |
YF-MA13633 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ID1 |
Anti-ID1 (3F8) |
YF-MA13634 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ID1 |
Anti-ID1 (3F3) |
YF-MA13635 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ID1 |
Anti-ID1 (4F6) |
YF-MA13636 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ID1 |
ID1 protein (His tag) |
80R-2751 |
Fitzgerald |
50 ug |
EUR 424 |
Description: Purified recombinant ID1 protein (His tag) |
Rat ID1 shRNA Plasmid |
20-abx984876 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ID1 shRNA Plasmid |
20-abx952307 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ID1 Recombinant Protein (Human) |
RP015526 |
ABM |
100 ug |
Ask for price |
ID1 Recombinant Protein (Rat) |
RP205430 |
ABM |
100 ug |
Ask for price |
ID1 Recombinant Protein (Mouse) |
RP142874 |
ABM |
100 ug |
Ask for price |
Anti-ID1 (4D7-1A2) |
YF-MA13625 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to ID1 |
Monoclonal ID1 Antibody (monoclonal) (M02), Clone: 1F7 |
AMM03647G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human ID1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1F7. This antibody is applicable in WB and IF, E |
Monoclonal ID1 Antibody (monoclonal) (M04), Clone: 4G11 |
AMM03648G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human ID1 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4G11. This antibody is applicable in WB and IF, E |
Id1 ORF Vector (Rat) (pORF) |
ORF068478 |
ABM |
1.0 ug DNA |
EUR 506 |
ID1 ORF Vector (Human) (pORF) |
ORF005176 |
ABM |
1.0 ug DNA |
EUR 95 |
Id1 ORF Vector (Mouse) (pORF) |
ORF047626 |
ABM |
1.0 ug DNA |
EUR 506 |
ID1 ELISA Kit (Human) (OKCA00658) |
OKCA00658 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Transcriptional regulator (lacking a basic DNA binding domain) which negatively regulates the basic helix-loop-helix (bHLH) transcription factors by forming heterodimers and inhibiting their DNA binding and transcriptional activity. Implicated in regulating a variety of cellular processes, including cellular growth, senescence, differentiation, apoptosis, angiogenesis, and neoplastic transformation. Inhibits skeletal muscle and cardiac myocyte differentiation. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.81 pg/mL |
ID1 ELISA Kit (Mouse) (OKCA01656) |
OKCA01656 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Transcriptional regulator (lacking a basic DNA binding domain) which negatively regulates the basic helix-loop-helix (bHLH) transcription factors by forming heterodimers and inhibiting their DNA binding and transcriptional activity. Implicated in regulating a variety of cellular processes, including cellular growth, senescence, differentiation, apoptosis, angiogenesis, and neoplastic transformation. Inhibits skeletal muscle and cardiac myocyte differentiation. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.86 pg/mL |
ID1 ELISA Kit (Rat) (OKCA01869) |
OKCA01869 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Transcriptional regulator (lacking a basic DNA binding domain) which negatively regulates the basic helix-loop-helix (bHLH) transcription factors by forming heterodimers and inhibiting their DNA binding and transcriptional activity. Implicated in regulating a variety of cellular processes, including cellular growth, senescence, differentiation, apoptosis, angiogenesis, and neoplastic transformation. Inhibits skeletal muscle and cardiac myocyte differentiation. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 pg/mL |
ID1 ELISA Kit (Human) (OKEH08357) |
OKEH08357 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with members of the basic HLH family of transcription factors. The encoded protein has no DNA binding activity and therefore can inhibit the DNA binding and transcriptional activation ability of basic HLH proteins with which it interacts. This protein may play a role in cell growth, senescence, and differentiation. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.159ng/mL |
Id1 ELISA Kit (Mouse) (OKEH08358) |
OKEH08358 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL |
ID1 ELISA Kit (Rat) (OKEH08359) |
OKEH08359 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: a negative regulator of gene transcription [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082ng/mL |
DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody |
20-abx009130 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody |
abx026408-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody |
abx026408-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody |
20-abx005928 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-1 (Id1) Antibody |
20-abx216130 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody |
20-abx113131 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody |
abx234114-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Id1 sgRNA CRISPR Lentivector set (Rat) |
K6801201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Id1 sgRNA CRISPR Lentivector set (Mouse) |
K4367701 |
ABM |
3 x 1.0 ug |
EUR 339 |
ID1 sgRNA CRISPR Lentivector set (Human) |
K1012301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Id1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6801202 |
ABM |
1.0 ug DNA |
EUR 154 |
Id1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6801203 |
ABM |
1.0 ug DNA |
EUR 154 |
Id1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6801204 |
ABM |
1.0 ug DNA |
EUR 154 |
Id1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4367702 |
ABM |
1.0 ug DNA |
EUR 154 |
Id1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4367703 |
ABM |
1.0 ug DNA |
EUR 154 |
Id1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4367704 |
ABM |
1.0 ug DNA |
EUR 154 |
ID1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1012302 |
ABM |
1.0 ug DNA |
EUR 154 |
ID1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1012303 |
ABM |
1.0 ug DNA |
EUR 154 |
ID1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1012304 |
ABM |
1.0 ug DNA |
EUR 154 |
ID1 Protein Vector (Human) (pPB-C-His) |
PV020701 |
ABM |
500 ng |
EUR 329 |
ID1 Protein Vector (Human) (pPB-N-His) |
PV020702 |
ABM |
500 ng |
EUR 329 |
ID1 Protein Vector (Human) (pPM-C-HA) |
PV020703 |
ABM |
500 ng |
EUR 329 |
ID1 Protein Vector (Human) (pPM-C-His) |
PV020704 |
ABM |
500 ng |
EUR 329 |
ID1 Protein Vector (Rat) (pPB-C-His) |
PV273910 |
ABM |
500 ng |
EUR 603 |
ID1 Protein Vector (Rat) (pPB-N-His) |
PV273911 |
ABM |
500 ng |
EUR 603 |
ID1 Protein Vector (Rat) (pPM-C-HA) |
PV273912 |
ABM |
500 ng |
EUR 603 |
ID1 Protein Vector (Rat) (pPM-C-His) |
PV273913 |
ABM |
500 ng |
EUR 603 |
ID1 Protein Vector (Mouse) (pPB-C-His) |
PV190502 |
ABM |
500 ng |
EUR 603 |
ID1 Protein Vector (Mouse) (pPB-N-His) |
PV190503 |
ABM |
500 ng |
EUR 603 |
ID1 Protein Vector (Mouse) (pPM-C-HA) |
PV190504 |
ABM |
500 ng |
EUR 603 |
ID1 Protein Vector (Mouse) (pPM-C-His) |
PV190505 |
ABM |
500 ng |
EUR 603 |
Id1 3'UTR Luciferase Stable Cell Line |
TU109874 |
ABM |
1.0 ml |
Ask for price |
Id1 3'UTR Luciferase Stable Cell Line |
TU206077 |
ABM |
1.0 ml |
Ask for price |
Id1 3'UTR GFP Stable Cell Line |
TU159874 |
ABM |
1.0 ml |
Ask for price |
Id1 3'UTR GFP Stable Cell Line |
TU256077 |
ABM |
1.0 ml |
Ask for price |
ID1 3'UTR GFP Stable Cell Line |
TU060400 |
ABM |
1.0 ml |
EUR 1364 |
ID1 3'UTR Luciferase Stable Cell Line |
TU010400 |
ABM |
1.0 ml |
EUR 1364 |
Human DNA-binding protein inhibitor ID-1 (ID1) |
1-CSB-EP010966HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 32.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human DNA-binding protein inhibitor ID-1(ID1) expressed in E.coli |
Zebrafish Id1 Rbt pAb, Protein A purified, 25UG |
A014-25UG |
Arbor Assays |
25UG |
EUR 425 |
ID1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV680287 |
ABM |
1.0 ug DNA |
EUR 514 |
ID1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV680291 |
ABM |
1.0 ug DNA |
EUR 514 |
ID1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV680292 |
ABM |
1.0 ug DNA |
EUR 514 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
ID1 Rabbit Polyclonal Antibody