HLA-DQA1 Rabbit Polyclonal Antibody
HLA-DQA1 Polyclonal Antibody |
ABP58795-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human HLA-DQA1 protein at amino acid sequence of 21-70
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DQA1 from Human. This HLA-DQA1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HLA-DQA1 protein at amino acid sequence of 21-70 |
HLA-DQA1 Polyclonal Antibody |
A52488 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
HLA-DQA1 Polyclonal Antibody |
46880-100ul |
SAB |
100ul |
EUR 252 |
HLA-DQA1 Polyclonal Antibody |
46880-50ul |
SAB |
50ul |
EUR 187 |
HLA-DQA1 Rabbit mAb |
A11252-100ul |
Abclonal |
100 ul |
EUR 410 |
HLA-DQA1 Rabbit mAb |
A11252-200ul |
Abclonal |
200 ul |
EUR 571 |
HLA-DQA1 Rabbit mAb |
A11252-20ul |
Abclonal |
20 ul |
EUR 221 |
HLA-DQA1 Rabbit mAb |
A11252-50ul |
Abclonal |
50 ul |
EUR 287 |
HLA-DQA1 Rabbit pAb |
A2168-100ul |
Abclonal |
100 ul |
EUR 308 |
HLA-DQA1 Rabbit pAb |
A2168-200ul |
Abclonal |
200 ul |
EUR 459 |
HLA-DQA1 Rabbit pAb |
A2168-20ul |
Abclonal |
20 ul |
EUR 183 |
HLA-DQA1 Rabbit pAb |
A2168-50ul |
Abclonal |
50 ul |
EUR 223 |
HLA-DQA1 antibody |
38391-100ul |
SAB |
100ul |
EUR 252 |
HLA-DQA1 Antibody |
49737-100ul |
SAB |
100ul |
EUR 333 |
HLA-DQA1 Antibody |
49737-50ul |
SAB |
50ul |
EUR 239 |
HLA-DQA1 Antibody |
DF6891 |
Affbiotech |
200ul |
EUR 304 |
Description: HLA-DQA1 Antibody detects endogenous levels of total HLA-DQA1. |
HLA-DQA1 Antibody |
1-CSB-PA14839A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HLA-DQA1. Recognizes HLA-DQA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
HLA-DQA2 & HLA-DQA1 Antibody |
abx432803-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Polyclonal HLA-DQA2 & HLA-DQA1 Antibody (C-Term) |
APG00711G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HLA-DQA2 & HLA-DQA1 (C-Term). This antibody is tested and proven to work in the following applications: |
Polyclonal HLA-DQA1 Antibody (N-term) |
APR03658G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DQA1 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal HLA-DQA1 Antibody (C-term) |
APR04813G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DQA1 (C-term). This antibody is tested and proven to work in the following applications: |
HLA-DQA1 Polyclonal Antibody, Biotin Conjugated |
A52485 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
HLA-DQA1 Polyclonal Antibody, FITC Conjugated |
A52486 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
HLA-DQA1 Polyclonal Antibody, HRP Conjugated |
A52487 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
HLA-DQA1 Conjugated Antibody |
C38391 |
SAB |
100ul |
EUR 397 |
HLA-DQA1 Conjugated Antibody |
C49737 |
SAB |
100ul |
EUR 397 |
HLA-DQA1 Antibody Pair |
abx117603-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
HLA-DQA1 Antibody (HRP) |
20-abx108371 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
HLA-DQA1 Antibody (Biotin) |
20-abx105533 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
HLA-DQA1 Antibody (FITC) |
20-abx106950 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-HLA-DQA1 antibody |
STJ98824 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to HLA-DQA1. |
Anti-HLA-DQA1 antibody |
STJ24026 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: HLA-DQA1 belongs to the HLA class II alpha chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B Lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa. It is encoded by 5 exons; exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. |
HLA-DQA1 siRNA |
20-abx919563 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-HLA-DQA1 |
YF-PA12347 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to HLA-DQA1 |
HLA-DQA1 Antibody, HRP conjugated |
1-CSB-PA14839B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HLA-DQA1. Recognizes HLA-DQA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
HLA-DQA1 Antibody, FITC conjugated |
1-CSB-PA14839C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HLA-DQA1. Recognizes HLA-DQA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
HLA-DQA1 Antibody, Biotin conjugated |
1-CSB-PA14839D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HLA-DQA1. Recognizes HLA-DQA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Anti-HLA-DQA1 Monoclonal Antibody |
M00232-1 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal HLA-DQA1 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat. |
HLA-DQA1 cloning plasmid |
CSB-CL365686HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 765
- Sequence: atgatcctaaacaaagctctgatgctgggggcccttgccctgaccaccgtgatgagcccctgtggaggtgaagacattgtggctgaccacgtcgcctcttatggtgtaaacttgtaccagtcttacggtccctctggccagtacacccatgaatttgatggagatgagcagttcta
- Show more
|
Description: A cloning plasmid for the HLA-DQA1 gene. |
HLA-DQA1 cloning plasmid |
CSB-CL365686HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 765
- Sequence: ATGATCCTAAACAAAGCTCTGATGCTGGGGACCCTTGCCCTGACCACCGTGATGAGCCCCTGTGGAGGTGAAGACATTGTGGCTGACCACGTCGCCTCTTATGGTGTAAACTTGTACCAGTCTTACGGTCCCTCTGGCCAGTACACCCATGAATTTGATGGAGATGAGCAGTTCTA
- Show more
|
Description: A cloning plasmid for the HLA-DQA1 gene. |
HLA-DQA1 cloning plasmid |
CSB-CL365686HU3-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 765
- Sequence: ATGATCCTAAACAAAGCTCTGATGCTGGGGGCCCTCGCCCTGACCACCGTGATGAGCCCTTGTGGAGGTGAAGACATTGTGGCTGACCACGTTGCCTCTTACGGTGTAAACTTGTACCAGTCTTACGGTCCCTCTGGCCAGTTCACCCATGAATTTGATGGAGACGAGGAGTTCTA
- Show more
|
Description: A cloning plasmid for the HLA-DQA1 gene. |
HLA-DQA1 Blocking Peptide |
DF6891-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-HLA-DQA1 (1A3) |
YF-MA13469 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HLA-DQA1 |
Human HLA-DQA1 shRNA Plasmid |
20-abx952128 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
HLA-DQA1 Recombinant Protein (Human) |
RP014881 |
ABM |
100 ug |
Ask for price |
HLA-DQA1 Recombinant Protein (Human) |
RP039835 |
ABM |
100 ug |
Ask for price |
HLA-DQA1 Recombinant Protein (Human) |
RP039838 |
ABM |
100 ug |
Ask for price |
MHC Class II DQA2 (HLA-DQA1) Antibody |
abx415101-025mg |
Abbexa |
0.25 mg |
EUR 592 |
|
HLA-DQA1 ORF Vector (Human) (pORF) |
ORF004961 |
ABM |
1.0 ug DNA |
EUR 95 |
HLA-DQA1 ORF Vector (Human) (pORF) |
ORF013279 |
ABM |
1.0 ug DNA |
EUR 354 |
HLA-DQA1 ORF Vector (Human) (pORF) |
ORF013280 |
ABM |
1.0 ug DNA |
EUR 354 |
MHC Class II DQA2 (HLA-DQA1) Antibody (FITC) |
abx415102-01mg |
Abbexa |
0.1 mg |
EUR 648 |
|
MHC Class II DQA2 (HLA-DQA1) Antibody (RPE) |
abx415103-100tests |
Abbexa |
100 tests |
EUR 718 |
|
HLA-DQA1 sgRNA CRISPR Lentivector set (Human) |
K0964601 |
ABM |
3 x 1.0 ug |
EUR 339 |
HLA Class II Histocompatibility Antigen, DQ Alpha 1 Chain (HLA-DQA1) Antibody |
20-abx109886 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
HLA Class II Histocompatibility Antigen, DQ Alpha 1 Chain (HLA-DQA1) Antibody |
20-abx001780 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
HLA Class II Histocompatibility Antigen, DQ Alpha 1 Chain (HLA-DQA1) Antibody |
abx025082-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
HLA Class II Histocompatibility Antigen, DQ Alpha 1 Chain (HLA-DQA1) Antibody |
abx025082-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
HLA Class II Histocompatibility Antigen, DQ Alpha 1 Chain (HLA-DQA1) Antibody |
20-abx225215 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
HLA-DQA1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0964602 |
ABM |
1.0 ug DNA |
EUR 154 |
HLA-DQA1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0964603 |
ABM |
1.0 ug DNA |
EUR 154 |
HLA-DQA1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0964604 |
ABM |
1.0 ug DNA |
EUR 154 |
HLA-DQA1 Protein Vector (Human) (pPB-C-His) |
PV053113 |
ABM |
500 ng |
EUR 481 |
HLA-DQA1 Protein Vector (Human) (pPB-N-His) |
PV053114 |
ABM |
500 ng |
EUR 481 |
HLA-DQA1 Protein Vector (Human) (pPM-C-HA) |
PV053115 |
ABM |
500 ng |
EUR 481 |
HLA-DQA1 Protein Vector (Human) (pPM-C-His) |
PV053116 |
ABM |
500 ng |
EUR 481 |
HLA-DQA1 Protein Vector (Human) (pPB-C-His) |
PV053117 |
ABM |
500 ng |
EUR 481 |
HLA-DQA1 Protein Vector (Human) (pPB-N-His) |
PV053118 |
ABM |
500 ng |
EUR 481 |
HLA-DQA1 Protein Vector (Human) (pPM-C-HA) |
PV053119 |
ABM |
500 ng |
EUR 481 |
HLA-DQA1 Protein Vector (Human) (pPM-C-His) |
PV053120 |
ABM |
500 ng |
EUR 481 |
Recombinant Human HLA-DQA1 Protein, His, E.coli-100ug |
QP8817-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human HLA-DQA1 Protein, His, E.coli-10ug |
QP8817-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human HLA-DQA1 Protein, His, E.coli-1mg |
QP8817-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human HLA-DQA1 Protein, His, E.coli-200ug |
QP8817-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human HLA-DQA1 Protein, His, E.coli-500ug |
QP8817-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human HLA-DQA1 Protein, His, E.coli-50ug |
QP8817-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
HLA-DQA1 Protein Vector (Human) (pPB-C-His) |
PV019841 |
ABM |
500 ng |
EUR 329 |
HLA-DQA1 Protein Vector (Human) (pPB-N-His) |
PV019842 |
ABM |
500 ng |
EUR 329 |
HLA-DQA1 Protein Vector (Human) (pPM-C-HA) |
PV019843 |
ABM |
500 ng |
EUR 329 |
HLA-DQA1 Protein Vector (Human) (pPM-C-His) |
PV019844 |
ABM |
500 ng |
EUR 329 |
HLA-DQA1 3'UTR Luciferase Stable Cell Line |
TU009908 |
ABM |
1.0 ml |
EUR 1394 |
HLA-DQA1 3'UTR GFP Stable Cell Line |
TU059908 |
ABM |
1.0 ml |
EUR 1394 |
Human HLA class II histocompatibility antigen, DQ alpha 1 chain (HLA-DQA1) |
1-CSB-RP148394h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 25.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human HLA class II histocompatibility antigen, DQ alpha 1 chain(HLA-DQA1),partial expressed in E.coli |
HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV703491 |
ABM |
1.0 ug DNA |
EUR 450 |
HLA-DQA1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV703495 |
ABM |
1.0 ug DNA |
EUR 450 |
HLA-DQA1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV703496 |
ABM |
1.0 ug DNA |
EUR 450 |
HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV703503 |
ABM |
1.0 ug DNA |
EUR 450 |
HLA-DQA1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV703507 |
ABM |
1.0 ug DNA |
EUR 450 |
HLA-DQA1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV703508 |
ABM |
1.0 ug DNA |
EUR 450 |
HLA-DQA1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K0964605 |
ABM |
3 x 1.0 ug |
EUR 376 |
Anti-HLA-DRA/Hla Dr Rabbit Monoclonal Antibody |
M01195-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal HLA-DRA/Hla Dr Antibody. Validated in IF, WB and tested in Human, Mouse, Rat. |
Polyclonal HLA-A Antibody |
APR03304G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-A . This antibody is tested and proven to work in the following applications: |
Polyclonal HLA-DPA1 Antibody |
APR05440G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DPA1 . This antibody is tested and proven to work in the following applications: |
HLA-DO? Polyclonal Antibody |
ES2536-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HLA-DO? from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
HLA-DO? Polyclonal Antibody |
ES2536-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HLA-DO? from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
HLA-DO? Polyclonal Antibody |
ES2537-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HLA-DO? from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HLA-DO? Polyclonal Antibody |
ES2537-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HLA-DO? from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HLA-H Polyclonal Antibody |
ES5742-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HLA-H from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HLA-H Polyclonal Antibody |
ES5742-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HLA-H from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HLA-DM? Polyclonal Antibody |
ES8783-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HLA-DM? from Human. This antibody is tested and validated for IHC, WB, ELISA |
HLA-DM? Polyclonal Antibody |
ES8783-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HLA-DM? from Human. This antibody is tested and validated for IHC, WB, ELISA |
HLA-DMBeta Polyclonal Antibody |
ABP58794-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human HLA-DM? protein at amino acid sequence of 40-100
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DMBeta from Human. This HLA-DMBeta antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HLA-DM? protein at amino acid sequence of 40-100 |
HLA-DMBeta Polyclonal Antibody |
ABP58794-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human HLA-DM? protein at amino acid sequence of 40-100
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DMBeta from Human. This HLA-DMBeta antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HLA-DM? protein at amino acid sequence of 40-100 |
HLA-DMBeta Polyclonal Antibody |
ABP58794-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human HLA-DM? protein at amino acid sequence of 40-100
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DMBeta from Human. This HLA-DMBeta antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HLA-DM? protein at amino acid sequence of 40-100 |
HLA-DPAlpha1 Polyclonal Antibody |
ABP54742-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DP?1
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DPAlpha1 from Human. This HLA-DPAlpha1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DP?1 |
HLA-DPAlpha1 Polyclonal Antibody |
ABP54742-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DP?1
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DPAlpha1 from Human. This HLA-DPAlpha1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DP?1 |
HLA-DPAlpha1 Polyclonal Antibody |
ABP54742-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DP?1
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DPAlpha1 from Human. This HLA-DPAlpha1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DP?1 |
HLA-H Polyclonal Antibody |
ABP54743-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human HLA-H at AA rangle: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-H from Human. This HLA-H antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-H at AA rangle: 40-120 |
HLA-H Polyclonal Antibody |
ABP54743-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human HLA-H at AA rangle: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-H from Human. This HLA-H antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-H at AA rangle: 40-120 |
HLA-H Polyclonal Antibody |
ABP54743-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human HLA-H at AA rangle: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-H from Human. This HLA-H antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-H at AA rangle: 40-120 |
HLA-DOAlpha Polyclonal Antibody |
ABP51537-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DO? at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DOAlpha from Human. This HLA-DOAlpha antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DO? at AA range: 40-120 |
HLA-DOAlpha Polyclonal Antibody |
ABP51537-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DO? at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DOAlpha from Human. This HLA-DOAlpha antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DO? at AA range: 40-120 |
HLA-DOAlpha Polyclonal Antibody |
ABP51537-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DO? at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DOAlpha from Human. This HLA-DOAlpha antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DO? at AA range: 40-120 |
HLA-DOBeta Polyclonal Antibody |
ABP51538-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human HLA-DO? at AA range: 10-90
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DOBeta from Human. This HLA-DOBeta antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human HLA-DO? at AA range: 10-90 |
HLA-DOBeta Polyclonal Antibody |
ABP51538-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human HLA-DO? at AA range: 10-90
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DOBeta from Human. This HLA-DOBeta antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human HLA-DO? at AA range: 10-90 |
HLA-DOBeta Polyclonal Antibody |
ABP51538-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human HLA-DO? at AA range: 10-90
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DOBeta from Human. This HLA-DOBeta antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human HLA-DO? at AA range: 10-90 |
HLA-DMA Polyclonal Antibody |
A59378 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
HLA-DRB4 Polyclonal Antibody |
A59382 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
HLA-DPB1 Polyclonal Antibody |
A57886 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
HLA-B Polyclonal Antibody |
A52237 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
HLA-DQA2 Polyclonal Antibody |
A52480 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
HLA-C Polyclonal Antibody |
A52484 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
HLA-DRA Polyclonal Antibody |
A53149 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
HLA-DPA1 Polyclonal Antibody |
A53174 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
HLA-G Polyclonal Antibody |
A53328 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
HLA-DRB1 Polyclonal Antibody |
A50716 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
HLA-E Polyclonal Antibody |
A50748 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
HLA-DRB1 Polyclonal Antibody |
A52026 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
HLA-DMA Polyclonal Antibody |
30759-100ul |
SAB |
100ul |
EUR 252 |
HLA-DMA Polyclonal Antibody |
30759-50ul |
SAB |
50ul |
EUR 187 |
HLA-DMB Polyclonal Antibody |
31536-100ul |
SAB |
100ul |
EUR 252 |
HLA-DMB Polyclonal Antibody |
31536-50ul |
SAB |
50ul |
EUR 187 |
HLA-F Polyclonal Antibody |
27409-100ul |
SAB |
100ul |
EUR 252 |
HLA-F Polyclonal Antibody |
27409-50ul |
SAB |
50ul |
EUR 187 |
BOLA-DQA1 ELISA Kit| Bovine BOLA-DQA1 ELISA Kit |
EF010993 |
Lifescience Market |
96 Tests |
EUR 689 |
HLA-DQA1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K0964606 |
ABM |
1.0 ug DNA |
EUR 167 |
HLA-DQA1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K0964607 |
ABM |
1.0 ug DNA |
EUR 167 |
HLA-DQA1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K0964608 |
ABM |
1.0 ug DNA |
EUR 167 |
HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA) |
LV703492 |
ABM |
1.0 ug DNA |
EUR 450 |
HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
LV703493 |
ABM |
1.0 ug DNA |
EUR 508 |
HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
LV703494 |
ABM |
1.0 ug DNA |
EUR 508 |
HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA) |
LV703504 |
ABM |
1.0 ug DNA |
EUR 450 |
HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
LV703505 |
ABM |
1.0 ug DNA |
EUR 508 |
HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
LV703506 |
ABM |
1.0 ug DNA |
EUR 508 |
Polyclonal HLA-B Antibody (Center) |
AMM05383G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-B (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal HLA-C Antibody (Center) |
AMM05384G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-C (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal HLA-DPB1 Antibody (Center) |
APR03874G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DPB1 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal HLA-DRB1 Antibody (Center) |
APR04623G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DRB1 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal HLA-DRB1 Antibody (Center) |
APR04702G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DRB1 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal HLA-F Antibody (Center) |
APR05687G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-F (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal HLA-G Antibody (Center) |
APR06131G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-G (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal HLA-DRB5 Antibody (Center) |
APR06202G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DRB5 (Center). This antibody is tested and proven to work in the following applications: |
HLA-DMA Polyclonal Conjugated Antibody |
C30759 |
SAB |
100ul |
EUR 397 |
HLA-DMB Polyclonal Conjugated Antibody |
C31536 |
SAB |
100ul |
EUR 397 |
HLA-F Polyclonal Conjugated Antibody |
C27409 |
SAB |
100ul |
EUR 397 |
HLA-DP?1 Polyclonal Antibody |
ES5741-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HLA-DP?1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HLA-DP?1 Polyclonal Antibody |
ES5741-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HLA-DP?1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HLA Class I Polyclonal Antibody |
ES8483-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HLA Class I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HLA Class I Polyclonal Antibody |
ES8483-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HLA Class I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HLA Class I Polyclonal Antibody |
ES8555-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HLA Class I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HLA Class I Polyclonal Antibody |
ES8555-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HLA Class I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HLA-DQB1/2 Polyclonal Antibody |
ES4222-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HLA-DQB1/2 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
HLA-DQB1/2 Polyclonal Antibody |
ES4222-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HLA-DQB1/2 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
HLA Class I Polyclonal Antibody |
ABP57490-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic Peptide of HLA Class I
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA Class I from Human. This HLA Class I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of HLA Class I |
HLA Class I Polyclonal Antibody |
ABP57490-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic Peptide of HLA Class I
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA Class I from Human. This HLA Class I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of HLA Class I |
HLA Class I Polyclonal Antibody |
ABP57490-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide of HLA Class I
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA Class I from Human. This HLA Class I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of HLA Class I |
HLA Class I Polyclonal Antibody |
ABP57562-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic peptide from human protein at AA range: 220-270
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA Class I from Human. This HLA Class I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 220-270 |
HLA Class I Polyclonal Antibody |
ABP57562-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic peptide from human protein at AA range: 220-270
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA Class I from Human. This HLA Class I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 220-270 |
HLA Class I Polyclonal Antibody |
ABP57562-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic peptide from human protein at AA range: 220-270
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA Class I from Human. This HLA Class I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 220-270 |
HLA-DQB1/2 Polyclonal Antibody |
ABP53223-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DQB1/2
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DQB1/2 from Human. This HLA-DQB1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DQB1/2 |
HLA-DQB1/2 Polyclonal Antibody |
ABP53223-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DQB1/2
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DQB1/2 from Human. This HLA-DQB1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DQB1/2 |
HLA-DQB1/2 Polyclonal Antibody |
ABP53223-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DQB1/2
- Applications tips:
|
Description: A polyclonal antibody for detection of HLA-DQB1/2 from Human. This HLA-DQB1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DQB1/2 |
HLA-DQB1/2 Polyclonal Antibody |
41863-100ul |
SAB |
100ul |
EUR 252 |
HLA-DQB1/2 Polyclonal Antibody |
41863-50ul |
SAB |
50ul |
EUR 187 |
HLA-DRB5 Rabbit pAb |
A9475-100ul |
Abclonal |
100 ul |
EUR 308 |
HLA-DRB5 Rabbit pAb |
A9475-200ul |
Abclonal |
200 ul |
EUR 459 |
HLA-DRB5 Rabbit pAb |
A9475-20ul |
Abclonal |
20 ul |
Ask for price |
HLA-DRB5 Rabbit pAb |
A9475-50ul |
Abclonal |
50 ul |
Ask for price |
HLA-C Rabbit pAb |
A1013-100ul |
Abclonal |
100 ul |
EUR 308 |
HLA-C Rabbit pAb |
A1013-200ul |
Abclonal |
200 ul |
EUR 459 |
HLA-C Rabbit pAb |
A1013-20ul |
Abclonal |
20 ul |
EUR 183 |
HLA-C Rabbit pAb |
A1013-50ul |
Abclonal |
50 ul |
EUR 223 |
HLA-F Rabbit pAb |
A10384-100ul |
Abclonal |
100 ul |
EUR 308 |
HLA-F Rabbit pAb |
A10384-200ul |
Abclonal |
200 ul |
EUR 459 |
HLA-F Rabbit pAb |
A10384-20ul |
Abclonal |
20 ul |
EUR 183 |
HLA-F Rabbit pAb |
A10384-50ul |
Abclonal |
50 ul |
EUR 223 |
HLA-DRA Rabbit mAb |
A10863-100ul |
Abclonal |
100 ul |
EUR 410 |
HLA-DRA Rabbit mAb |
A10863-200ul |
Abclonal |
200 ul |
EUR 571 |
HLA-DRA Rabbit mAb |
A10863-20ul |
Abclonal |
20 ul |
EUR 221 |
HLA-DRA Rabbit mAb |
A10863-50ul |
Abclonal |
50 ul |
EUR 287 |
HLA-DQB2 Rabbit pAb |
A11605-100ul |
Abclonal |
100 ul |
EUR 308 |
HLA-DQB2 Rabbit pAb |
A11605-200ul |
Abclonal |
200 ul |
EUR 459 |
HLA-DQB2 Rabbit pAb |
A11605-20ul |
Abclonal |
20 ul |
EUR 183 |
HLA-DQB2 Rabbit pAb |
A11605-50ul |
Abclonal |
50 ul |
EUR 223 |
HLA-DQB2 Rabbit pAb |
A11652-100ul |
Abclonal |
100 ul |
EUR 308 |
HLA-DQA1 Rabbit Polyclonal Antibody