HIPK1 Rabbit Polyclonal Antibody

HIPK1 Rabbit Polyclonal Antibody


HIPK1 Polyclonal Antibody

ABP58782-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950
  • Applications tips:
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950

HIPK1 Polyclonal Antibody

ABP58782-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950
  • Applications tips:
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950

HIPK1 Polyclonal Antibody

ES8953-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HIPK1 Polyclonal Antibody

ES8953-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HIPK1 Polyclonal Antibody

ES9076-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HIPK1 Polyclonal Antibody

ES9076-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HIPK1 antibody

70R-2078 50 ug
EUR 467
Description: Rabbit polyclonal HIPK1 antibody raised against the middle region of HIPK1

HIPK1 Antibody

37619-100ul 100ul
EUR 252

HIPK1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

HIPK1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

HIPK1 Antibody

DF8847 200ul
EUR 304
Description: HIPK1 Antibody detects endogenous levels of total HIPK1.

HIPK1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:50-1:100

HIPK1 Antibody

ABD8847 100 ug
EUR 438

Polyclonal HIPK1 Antibody (C-term)

APR16693G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HIPK1 (C-term). This antibody is tested and proven to work in the following applications:

HIPK1 Polyclonal Antibody, HRP Conjugated

A69028 100 ?g
EUR 628.55
Description: fast delivery possible

HIPK1 Polyclonal Antibody, FITC Conjugated

A69029 100 ?g
EUR 628.55
Description: reagents widely cited

HIPK1 Polyclonal Antibody, Biotin Conjugated

A69030 100 ?g
EUR 628.55
Description: Ask the seller for details

HIPK1 Conjugated Antibody

C37619 100ul
EUR 397

Anti-HIPK1 Antibody

STJ501340 100 µg
EUR 476

Anti-HIPK1 antibody

STJ190111 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HIPK1

Anti-HIPK1 antibody

STJ190234 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HIPK1

Hipk1/ Rat Hipk1 ELISA Kit

ELI-38786r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA26972 50 ul
EUR 334
Description: Mouse polyclonal to HIPK1

HIPK1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HIPK1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HIPK1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HIPK1/2/3 Antibody

DF10333 200ul
EUR 304
Description: HIPK1/2/3 Antibody detects endogenous levels of HIPK1/2/3.

Anti-HIPK1 Antibody (Biotin)

STJ501341 100 µg
EUR 586

Anti-HIPK1 Antibody (FITC)

STJ501342 100 µg
EUR 586

HIPK1 Blocking Peptide

33R-7200 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HIPK1 antibody, catalog no. 70R-2078

HIPK1 Blocking Peptide

DF8847-BP 1mg
EUR 195

HIPK1 cloning plasmid

CSB-CL803159HU-10ug 10ug
EUR 796
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2451
  • Sequence: atggttttgatgtttcagattcgttatatttcacaaacacaaggcttgccagctgaatatcttctcagtgccggaacaaaaacaaccaggtttttcaacagagatcctaatttggggtacccactgtggaggcttaagacacctgaagaacatgaactggagactggaataaaat
  • Show more
Description: A cloning plasmid for the HIPK1 gene.

Anti-HIPK1 (4C2)

YF-MA11764 100 ug
EUR 363
Description: Mouse monoclonal to HIPK1


HIPK1 Rabbit Polyclonal Antibody