HDGF Rabbit Polyclonal Antibody
HDGF Polyclonal Antibody |
ES8731-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HDGF from Human. This antibody is tested and validated for IHC, WB, ELISA |
HDGF Polyclonal Antibody |
ABP58763-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
- Applications tips:
|
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190 |
HDGF Polyclonal Antibody |
ABP58763-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
- Applications tips:
|
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190 |
HDGF Polyclonal Antibody |
ABP58763-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
- Applications tips:
|
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190 |
HDGF Polyclonal Antibody |
A53048 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
HDGF Polyclonal Antibody |
46852-100ul |
SAB |
100ul |
EUR 252 |
HDGF Polyclonal Antibody |
46852-50ul |
SAB |
50ul |
EUR 187 |
HDGF Rabbit pAb |
A5347-100ul |
Abclonal |
100 ul |
EUR 308 |
HDGF Rabbit pAb |
A5347-200ul |
Abclonal |
200 ul |
EUR 459 |
HDGF Rabbit pAb |
A5347-20ul |
Abclonal |
20 ul |
EUR 183 |
HDGF Rabbit pAb |
A5347-50ul |
Abclonal |
50 ul |
EUR 223 |
HDGF Rabbit pAb |
A13654-100ul |
Abclonal |
100 ul |
EUR 308 |
HDGF Rabbit pAb |
A13654-200ul |
Abclonal |
200 ul |
EUR 459 |
HDGF Rabbit pAb |
A13654-20ul |
Abclonal |
20 ul |
EUR 183 |
HDGF Rabbit pAb |
A13654-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit |
DLR-HDGF-Hu-48T |
DL Develop |
48T |
EUR 425 |
- Should the Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit |
DLR-HDGF-Hu-96T |
DL Develop |
96T |
EUR 548 |
- Should the Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit |
DLR-HDGF-Mu-48T |
DL Develop |
48T |
EUR 435 |
- Should the Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit |
DLR-HDGF-Mu-96T |
DL Develop |
96T |
EUR 561 |
- Should the Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit |
RD-HDGF-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 418 |
Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit |
RD-HDGF-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 575 |
Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit |
RD-HDGF-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 429 |
Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit |
RD-HDGF-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 591 |
Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit |
RDR-HDGF-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 436 |
Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit |
RDR-HDGF-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 601 |
Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit |
RDR-HDGF-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 447 |
Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit |
RDR-HDGF-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 618 |
Rabbit HDGF ELISA Kit |
ERTH0054 |
Abclonal |
96Tests |
EUR 521 |
Polyclonal HDGF Antibody (C-term) |
APR05752G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDGF (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal HDGF Antibody (C-term) |
APR06952G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDGF (C-term). This antibody is tested and proven to work in the following applications: |
HDGF Polyclonal Antibody, HRP Conjugated |
A53045 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
HDGF Polyclonal Antibody, FITC Conjugated |
A53046 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
HDGF Polyclonal Antibody, Biotin Conjugated |
A53047 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
HDGF Antibody |
32788-100ul |
SAB |
100ul |
EUR 252 |
HDGF antibody |
10R-1523 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal HDGF antibody |
HDGF antibody |
70R-17711 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal HDGF antibody |
HDGF Antibody |
DF7289 |
Affbiotech |
200ul |
EUR 304 |
Description: HDGF Antibody detects endogenous levels of total HDGF. |
HDGF Antibody |
1-CSB-PA01004A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
HDGF Antibody |
1-CSB-PA010249GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
HDGF Conjugated Antibody |
C32788 |
SAB |
100ul |
EUR 397 |
anti- HDGF antibody |
FNab03808 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: hepatoma-derived growth factor (high-mobility group protein 1-like)
- Uniprot ID: P51858
- Gene ID: 3068
- Research Area: Cancer, Signal Transduction, Metabolism
|
Description: Antibody raised against HDGF |
anti- HDGF antibody |
FNab03809 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:1000-1:5000
- IF: 1:10-1:100
- IHC: 1:50-1:500
- Immunogen: hepatoma-derived growth factor(high-mobility group protein 1-like)
- Uniprot ID: P51858
- Gene ID: 81932
- Research Area: Cancer, Signal Transduction, Metabolism
|
Description: Antibody raised against HDGF |
Anti-HDGF Antibody |
A01057 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-HDGF antibody |
STJ98794 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to HDGF. |
Anti-HDGF antibody |
STJ27300 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described. |
Anti-HDGF antibody |
STJ115610 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described. |
HDGF siRNA |
20-abx902439 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HDGF siRNA |
20-abx919203 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HDGF siRNA |
20-abx919204 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HDGF protein |
30R-1402 |
Fitzgerald |
100 ug |
EUR 397 |
Description: Purified recombinant Human HDGF protein |
anti-HDGF |
YF-PA12275 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to HDGF |
anti-HDGF |
YF-PA23871 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to HDGF |
HDGF Antibody, HRP conjugated |
1-CSB-PA01004B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
HDGF Antibody, FITC conjugated |
1-CSB-PA01004C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
HDGF Antibody, Biotin conjugated |
1-CSB-PA01004D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human) |
4-PAA624Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Tyr10~Leu240)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF) |
HDGF cloning plasmid |
CSB-CL010249HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 723
- Sequence: atgtcgcgatccaaccggcagaaggagtacaaatgcggggacctggtgttcgccaagatgaagggctacccacactggccggcccggattgacgagatgcctgaggctgccgtgaaatcaacagccaacaaataccaagtcttttttttcgggacccacgagacggcattcctggg
- Show more
|
Description: A cloning plasmid for the HDGF gene. |
HDGF Blocking Peptide |
DF7289-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-HDGF (2D6) |
YF-MA13429 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HDGF |
HDGF Like 3 (HDGFL3) Antibody |
20-abx327580 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), APC |
4-PAA624Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Tyr10~Leu240)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC. |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), Biotinylated |
4-PAA624Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Tyr10~Leu240)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Biotin. |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), Cy3 |
4-PAA624Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Tyr10~Leu240)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Cy3. |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), FITC |
4-PAA624Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Tyr10~Leu240)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with FITC. |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), HRP |
4-PAA624Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Tyr10~Leu240)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with HRP. |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), PE |
4-PAA624Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Tyr10~Leu240)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with PE. |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse) |
4-PAA624Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Asp14~Gly187)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF) |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), APC-Cy7 |
4-PAA624Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Tyr10~Leu240)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC-Cy7. |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), APC |
4-PAA624Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Asp14~Gly187)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC. |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAA624Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Asp14~Gly187)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Biotin. |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAA624Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Asp14~Gly187)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Cy3. |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), FITC |
4-PAA624Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Asp14~Gly187)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with FITC. |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), HRP |
4-PAA624Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Asp14~Gly187)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with HRP. |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), PE |
4-PAA624Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Asp14~Gly187)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with PE. |
Hepatoma Derived Growth Factor (HDGF) Antibody |
20-abx112980 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Hepatoma Derived Growth Factor (HDGF) Antibody |
20-abx128720 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Hepatoma Derived Growth Factor (HDGF) Antibody |
20-abx109863 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Hepatoma Derived Growth Factor (HDGF) Antibody |
20-abx103152 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Hepatoma Derived Growth Factor (HDGF) Antibody |
abx032817-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Hepatoma Derived Growth Factor (HDGF) Antibody |
abx032817-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Hepatoma Derived Growth Factor (HDGF) Antibody |
20-abx004089 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Hepatoma Derived Growth Factor (HDGF) Antibody |
20-abx172791 |
Abbexa |
|
|
|
Hepatoma Derived Growth Factor (HDGF) Antibody |
20-abx176825 |
Abbexa |
|
|
|
Hepatoma Derived Growth Factor (HDGF) Antibody |
20-abx176826 |
Abbexa |
|
|
|
Hepatoma Derived Growth Factor (HDGF) Antibody |
abx233808-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Hepatoma Derived Growth Factor (HDGF) Antibody |
abx233809-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Hepatoma Derived Growth Factor (HDGF) Antibody |
20-abx225213 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Rat HDGF shRNA Plasmid |
20-abx987193 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human HDGF ELISA Kit |
EHH0054 |
Abclonal |
96Tests |
EUR 521 |
Goat HDGF ELISA Kit |
EGTH0054 |
Abclonal |
96Tests |
EUR 521 |
Bovine HDGF ELISA Kit |
EBH0054 |
Abclonal |
96Tests |
EUR 521 |
Anserini HDGF ELISA Kit |
EAH0054 |
Abclonal |
96Tests |
EUR 521 |
Porcine HDGF ELISA Kit |
EPH0054 |
Abclonal |
96Tests |
EUR 521 |
Rat HDGF ELISA Kit |
ERH0054 |
Abclonal |
96Tests |
EUR 521 |
Mouse HDGF ELISA Kit |
EMH0054 |
Abclonal |
96Tests |
EUR 521 |
Mouse HDGF shRNA Plasmid |
20-abx970772 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human HDGF shRNA Plasmid |
20-abx952089 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
HDGF Recombinant Protein (Human) |
RP014515 |
ABM |
100 ug |
Ask for price |
HDGF Recombinant Protein (Rat) |
RP204359 |
ABM |
100 ug |
Ask for price |
HDGF Recombinant Protein (Mouse) |
RP141161 |
ABM |
100 ug |
Ask for price |
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAA624Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HDGF (Asp14~Gly187)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC-Cy7. |
Hepatoma Derived Growth Factor (HDGF) Antibody (HRP) |
20-abx108345 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Hepatoma Derived Growth Factor (HDGF) Antibody (Biotin) |
20-abx105506 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Hepatoma Derived Growth Factor (HDGF) Antibody (FITC) |
20-abx106923 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Hepatoma-Derived Growth Factor (HDGF) Antibody |
32013-05111 |
AssayPro |
150 ug |
EUR 261 |
Guinea Pig HDGF ELISA Kit |
EGH0054 |
Abclonal |
96Tests |
EUR 521 |
HDGF ORF Vector (Human) (pORF) |
ORF004839 |
ABM |
1.0 ug DNA |
EUR 95 |
Hdgf ORF Vector (Rat) (pORF) |
ORF068121 |
ABM |
1.0 ug DNA |
EUR 506 |
Hdgf ORF Vector (Mouse) (pORF) |
ORF047055 |
ABM |
1.0 ug DNA |
EUR 506 |
HDGF ELISA Kit (Human) (OKCD00249) |
OKCD00249 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Heparin-binding protein, with mitogenic activity for fibroblasts. Acts as a transcriptional repressor.1 Publication
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.11"Hepatoma-derived growth factor binds DNA through the N-terminal PWWP domain."_x005F_x005F_x000D_Yang J., Everett A.D._x005F_x005F_x000D_BMC Mol. Biol. 8:101-101(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, DNA-BINDING. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL |
Hdgf ELISA Kit (Mouse) (OKCD01531) |
OKCD01531 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Heparin-binding protein, with mitogenic activity for fibroblasts. Acts as a transcriptional repressor.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.4 pg/mL |
HDGF ELISA Kit (Human) (OKAN06027) |
OKAN06027 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL |
HDGF sgRNA CRISPR Lentivector set (Human) |
K0941201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Hdgf sgRNA CRISPR Lentivector set (Mouse) |
K4641401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mouse Hepatoma-derived growth factor (Hdgf) |
1-CSB-YP010249MO |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 30.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Hepatoma-derived growth factor(Hdgf) expressed in Yeast |
Hdgf sgRNA CRISPR Lentivector set (Rat) |
K6948001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Hepatoma Derived Growth Factor (HDGF) |
4-RPA624Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P51858
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.5kDa
- Isoelectric Point: 4.9
|
Description: Recombinant Human Hepatoma Derived Growth Factor expressed in: E.coli |
Recombinant Hepatoma Derived Growth Factor (HDGF) |
4-RPA624Mu01 |
Cloud-Clone |
-
EUR 483.49
-
EUR 232.00
-
EUR 1538.08
-
EUR 579.36
-
EUR 1058.72
-
EUR 386.00
-
EUR 3695.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P51859
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 20.8kDa
- Isoelectric Point: 5.4
|
Description: Recombinant Mouse Hepatoma Derived Growth Factor expressed in: E.coli |
Human Hepatoma-Derived Growth Factor (HDGF) Antibody (Biotin Conjugate) |
32013-05121 |
AssayPro |
150 ug |
EUR 369 |
Rat Hepatoma Derived Growth Factor (HDGF) Protein |
20-abx653734 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
HDGF sgRNA CRISPR Lentivector (Human) (Target 1) |
K0941202 |
ABM |
1.0 ug DNA |
EUR 154 |
HDGF sgRNA CRISPR Lentivector (Human) (Target 2) |
K0941203 |
ABM |
1.0 ug DNA |
EUR 154 |
HDGF sgRNA CRISPR Lentivector (Human) (Target 3) |
K0941204 |
ABM |
1.0 ug DNA |
EUR 154 |
Mouse Hepatoma Derived Growth Factor (HDGF) Protein |
20-abx067076 |
Abbexa |
-
EUR 676.00
-
EUR 272.00
-
EUR 2068.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Hepatoma Derived Growth Factor (HDGF) Protein |
20-abx168070 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Hepatoma Derived Growth Factor (HDGF) Protein |
20-abx261882 |
Abbexa |
-
EUR 4490.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Hdgf sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4641402 |
ABM |
1.0 ug DNA |
EUR 154 |
Hdgf sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4641403 |
ABM |
1.0 ug DNA |
EUR 154 |
Hdgf sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4641404 |
ABM |
1.0 ug DNA |
EUR 154 |
Hdgf sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6948002 |
ABM |
1.0 ug DNA |
EUR 154 |
Hdgf sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6948003 |
ABM |
1.0 ug DNA |
EUR 154 |
Hdgf sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6948004 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Human HDGF Protein, Untagged, E.coli-1mg |
QP12205-1mg |
EnQuireBio |
1mg |
EUR 3655 |
Recombinant Human HDGF Protein, Untagged, E.coli-20ug |
QP12205-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human HDGF Protein, Untagged, E.coli-5ug |
QP12205-5ug |
EnQuireBio |
5ug |
EUR 155 |
HDGF Protein Vector (Rat) (pPB-C-His) |
PV272482 |
ABM |
500 ng |
EUR 603 |
HDGF Protein Vector (Rat) (pPB-N-His) |
PV272483 |
ABM |
500 ng |
EUR 603 |
HDGF Protein Vector (Rat) (pPM-C-HA) |
PV272484 |
ABM |
500 ng |
EUR 603 |
HDGF Protein Vector (Rat) (pPM-C-His) |
PV272485 |
ABM |
500 ng |
EUR 603 |
HDGF Protein Vector (Human) (pPB-C-His) |
PV019353 |
ABM |
500 ng |
EUR 329 |
HDGF Protein Vector (Human) (pPB-N-His) |
PV019354 |
ABM |
500 ng |
EUR 329 |
HDGF Protein Vector (Human) (pPM-C-HA) |
PV019355 |
ABM |
500 ng |
EUR 329 |
HDGF Protein Vector (Human) (pPM-C-His) |
PV019356 |
ABM |
500 ng |
EUR 329 |
HDGF Protein Vector (Mouse) (pPB-C-His) |
PV188218 |
ABM |
500 ng |
EUR 603 |
HDGF Protein Vector (Mouse) (pPB-N-His) |
PV188219 |
ABM |
500 ng |
EUR 603 |
HDGF Protein Vector (Mouse) (pPM-C-HA) |
PV188220 |
ABM |
500 ng |
EUR 603 |
HDGF Protein Vector (Mouse) (pPM-C-His) |
PV188221 |
ABM |
500 ng |
EUR 603 |
Hdgf 3'UTR Luciferase Stable Cell Line |
TU205696 |
ABM |
1.0 ml |
Ask for price |
Hdgf 3'UTR GFP Stable Cell Line |
TU159417 |
ABM |
1.0 ml |
Ask for price |
HDGF 3'UTR Luciferase Stable Cell Line |
TU009672 |
ABM |
1.0 ml |
EUR 1394 |
Hdgf 3'UTR Luciferase Stable Cell Line |
TU109417 |
ABM |
1.0 ml |
Ask for price |
HDGF 3'UTR GFP Stable Cell Line |
TU059672 |
ABM |
1.0 ml |
EUR 1394 |
Hdgf 3'UTR GFP Stable Cell Line |
TU255696 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HDGF Rabbit Polyclonal Antibody