GSTA1 Rabbit Polyclonal Antibody

GSTA1 Rabbit Polyclonal Antibody


GSTA1 Polyclonal Antibody

ES8739-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GSTA1 from Human. This antibody is tested and validated for IHC, WB, ELISA

GSTA1 Polyclonal Antibody

ES8739-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GSTA1 from Human. This antibody is tested and validated for IHC, WB, ELISA

GSTA1 Polyclonal Antibody

ABP58728-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140
  • Applications tips:
Description: A polyclonal antibody for detection of GSTA1 from Human. This GSTA1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140

GSTA1 Polyclonal Antibody

ABP58728-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140
  • Applications tips:
Description: A polyclonal antibody for detection of GSTA1 from Human. This GSTA1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140

GSTA1 Polyclonal Antibody

ABP58728-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140
  • Applications tips:
Description: A polyclonal antibody for detection of GSTA1 from Human. This GSTA1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140

GSTA1 Polyclonal Antibody

A62710 100 µg
EUR 570.55
Description: The best epigenetics products

GSTA1 Polyclonal Antibody

46859-100ul 100ul
EUR 252

GSTA1 Polyclonal Antibody

46859-50ul 50ul
EUR 187

GSTA1 Rabbit pAb

A18266-100ul 100 ul
EUR 308

GSTA1 Rabbit pAb

A18266-200ul 200 ul
EUR 459

GSTA1 Rabbit pAb

A18266-20ul 20 ul
EUR 183

GSTA1 Rabbit pAb

A18266-50ul 50 ul
EUR 223

GSTA1 Rabbit pAb

A1628-100ul 100 ul
EUR 308

GSTA1 Rabbit pAb

A1628-200ul 200 ul
EUR 459

GSTA1 Rabbit pAb

A1628-20ul 20 ul
EUR 183

GSTA1 Rabbit pAb

A1628-50ul 50 ul
EUR 223

Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

DLR-GSTa1-Hu-48T 48T
EUR 479
  • Should the Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

DLR-GSTa1-Hu-96T 96T
EUR 621
  • Should the Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

DLR-GSTa1-Mu-48T 48T
EUR 489
  • Should the Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma or other biological fluids.

Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

DLR-GSTa1-Mu-96T 96T
EUR 635
  • Should the Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma or other biological fluids.

Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

DLR-GSTa1-Ra-48T 48T
EUR 508
  • Should the Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

DLR-GSTa1-Ra-96T 96T
EUR 661
  • Should the Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

RD-GSTa1-Hu-48Tests 48 Tests
EUR 478

Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

RD-GSTa1-Hu-96Tests 96 Tests
EUR 662

Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

RD-GSTa1-Mu-48Tests 48 Tests
EUR 489

Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

RD-GSTa1-Mu-96Tests 96 Tests
EUR 677

Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

RD-GSTa1-Ra-48Tests 48 Tests
EUR 511

Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

RD-GSTa1-Ra-96Tests 96 Tests
EUR 709

Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

RDR-GSTa1-Hu-48Tests 48 Tests
EUR 500

Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

RDR-GSTa1-Hu-96Tests 96 Tests
EUR 692

Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

RDR-GSTa1-Mu-48Tests 48 Tests
EUR 511

Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

RDR-GSTa1-Mu-96Tests 96 Tests
EUR 709

Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

RDR-GSTa1-Ra-48Tests 48 Tests
EUR 534

Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit

RDR-GSTa1-Ra-96Tests 96 Tests
EUR 742

Rabbit GSTa1 ELISA Kit

ERTG0274 96Tests
EUR 521

GSTA1 Polyclonal Antibody, HRP Conjugated

A62711 100 µg
EUR 570.55
Description: kits suitable for this type of research

GSTA1 Polyclonal Antibody, FITC Conjugated

A62712 100 µg
EUR 570.55
Description: fast delivery possible

GSTA1 Polyclonal Antibody, Biotin Conjugated

A62713 100 µg
EUR 570.55
Description: reagents widely cited

GSTA1 Antibody

ABD6514 100 ug
EUR 438

GSTA1 Antibody

32353-100ul 100ul
EUR 252

GSTA1 antibody

22536-100ul 100ul
EUR 390

GSTA1 antibody

70R-17620 50 ul
EUR 435
Description: Rabbit polyclonal GSTA1 antibody

GSTA1 antibody

70R-13136 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GSTA1 antibody

GSTA1 Antibody

DF6514 200ul
EUR 304
Description: GSTA1 Antibody detects endogenous levels of total GSTA1.

GSTA1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

GSTA1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Gsta1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gsta1. Recognizes Gsta1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

GSTA1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GSTA1 Conjugated Antibody

C32353 100ul
EUR 397

anti- GSTA1 antibody

FNab03686 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:200-1:500
  • IF: 1:10-1:100
  • Immunogen: glutathione S-transferase alpha 1
  • Uniprot ID: P08263
  • Gene ID: 2938
  • Research Area: Metabolism
Description: Antibody raised against GSTA1

Anti-GSTA1 Antibody

A01462 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GSTA1 Antibody (GSTA1) detection.tested for IHC in Human.

Human GSTA1 Antibody

32238-05111 150 ug
EUR 261

Anti-GSTA1 antibody

PAab03686 100 ug
EUR 355

Anti-GSTA1 antibody

STJ98802 200 µl
EUR 197
Description: Rabbit polyclonal to GSTA1.

Anti-GSTA1 antibody

STJ11100222 100 µl
EUR 277
Description: This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants.

Anti-GSTA1 antibody

STJ23884 100 µl
EUR 277
Description: This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants.

Gsta1/ Rat Gsta1 ELISA Kit

ELI-19370r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSTA1 protein

80R-4224 50 ug
EUR 349
Description: Recombinant Mouse GSTA1 protein with His tag

GSTA1 protein

30R-1443 100 ug
EUR 268
Description: Purified recombinant Human GSTA1 protein

GSTA1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Gsta1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gsta1. Recognizes Gsta1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

GSTA1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

Gsta1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gsta1. Recognizes Gsta1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

GSTA1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Gsta1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gsta1. Recognizes Gsta1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

GSTA1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GSTA1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GSTA1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Monoclonal GSTA1 Antibody, Clone: 286CT8.1.5

APR10881G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GSTA1. The antibodies are raised in Mouse and are from clone 286CT8.1.5. This antibody is applicable in WB, E

Human GSTA1 Antibody (Biotin Conjugate)

32238-05121 150 ug
EUR 369

GSTA1 cloning plasmid

CSB-CL009970HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 669
  • Sequence: atggcagagaagcccaagctccactacttcaatgcacggggcagaatggagtccacccggtggctcctggctgcagctggagtagagtttgaagagaaatttataaaatctgcagaagatttggacaagttaagaaatgatggatatttgatgttccagcaagtgccaatggttga
  • Show more
Description: A cloning plasmid for the GSTA1 gene.

Human Recombinant GSTA1

EUR 425

GSTA1 Blocking Peptide

DF6514-BP 1mg
EUR 195

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ser2~Phe222)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1)

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse)

  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Phe222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1)

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Gln223)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1)

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ser2~Phe222)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ser2~Phe222)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Biotin.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ser2~Phe222)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Cy3.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ser2~Phe222)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with FITC.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ser2~Phe222)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with HRP.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ser2~Phe222)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with PE.

Monoclonal GSTA1 Antibody (ascites), Clone: 286CT8.1.5

AMM05230G 0.1 ml
EUR 484
Description: A Monoclonal antibody against Human GSTA1 (ascites). The antibodies are raised in Mouse and are from clone 286CT8.1.5. This antibody is applicable in WB, E

Human GSTA1 AssayLite Antibody (FITC Conjugate)

32238-05141 150 ug
EUR 428

Human GSTA1 AssayLite Antibody (RPE Conjugate)

32238-05151 150 ug
EUR 428

Human GSTA1 AssayLite Antibody (APC Conjugate)

32238-05161 150 ug
EUR 428

Human GSTA1 AssayLite Antibody (PerCP Conjugate)

32238-05171 150 ug
EUR 471

Rat GSTA1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GSTa1 ELISA Kit

EHG0274 96Tests
EUR 521

Goat GSTa1 ELISA Kit

EGTG0274 96Tests
EUR 521

Canine GSTa1 ELISA Kit

ECG0274 96Tests
EUR 521

Chicken GSTa1 ELISA Kit

ECKG0274 96Tests
EUR 521

Bovine GSTa1 ELISA Kit

EBG0274 96Tests
EUR 521

Anserini GSTa1 ELISA Kit

EAG0274 96Tests
EUR 521

Porcine GSTa1 ELISA Kit

EPG0274 96Tests
EUR 521


ERG0274 96Tests
EUR 521

Sheep GSTa1 ELISA Kit

ESG0274 96Tests
EUR 521

Mouse GSTa1 ELISA Kit

EMG0274 96Tests
EUR 521

Monkey GSTa1 ELISA Kit

EMKG0274 96Tests
EUR 521

Mouse GSTA1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GSTA1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GSTA1 Recombinant Protein (Human)

RP014101 100 ug Ask for price


PVT16049 2 ug
EUR 325

GSTA1 Recombinant Protein (Mouse)

RP140231 100 ug Ask for price

Rabbit Glutathione S Transferase Alpha 1 (GSTA1) ELISA Kit

abx363363-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), APC

  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Phe222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Phe222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Biotin.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Phe222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Cy3.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Phe222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with FITC.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Phe222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with HRP.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), PE

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Phe222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with PE.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), APC

  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Gln223)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), Biotinylated

  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Gln223)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Biotin.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), Cy3

  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Gln223)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Cy3.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), FITC

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Gln223)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with FITC.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), HRP

  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Gln223)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with HRP.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), PE

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Gln223)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with PE.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ser2~Phe222)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC-Cy7.

Monoclonal GSTA1 Antibody (clone 2F7), Clone: 2F7

AMM05231G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human GSTA1 (clone 2F7). The antibodies are raised in Mouse and are from clone 2F7. This antibody is applicable in WB and IHC-P, E

Monoclonal GSTA1 Antibody (monoclonal) (M01), Clone: 2F7

AMM05232G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GSTA1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2F7. This antibody is applicable in WB and IHC, E

Monoclonal GSTA1 Antibody (monoclonal) (M08), Clone: 1F9

AMM05233G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GSTA1 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 1F9. This antibody is applicable in WB, E

Glutathione S-Transferase Alpha-1 (GSTA1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody

  • EUR 314.00
  • EUR 787.00
  • EUR 411.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody

abx034069-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody

abx034069-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody

abx025297-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody

abx025298-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody

abx025298-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody

  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody

abx340021-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody

abx233686-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-GSTA1/A2/A3/A4/A5 Antibody

A01462-1 100ug/vial
EUR 334

Anti-GSTA1/A2/A3/A4/A5 Antibody

A01462-2 100ug/vial
EUR 294

Mouse Glutathione S-Transferase A1 (GSTA1) Antibody

32145-05111 150 ug
EUR 261


PB9627 100ug/vial
EUR 294

Guinea Pig GSTa1 ELISA Kit

EGG0274 96Tests
EUR 521

GSTA1 ORF Vector (Human) (pORF)

ORF004701 1.0 ug DNA
EUR 95

Gsta1 ORF Vector (Mouse) (pORF)

ORF046745 1.0 ug DNA
EUR 506

GSTA1 ELISA Kit (Mouse) (OKCD00806)

OKCD00806 96 Wells
EUR 779
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.129 ng/mL

GSTA1 ELISA Kit (Human) (OKCD01133)

OKCD01133 96 Wells
EUR 792
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.23"The role of a topologically conserved isoleucine in glutathione transferase structure, stability and function."_x005F_x005F_x000D_Achilonu I., Gildenhuys S., Fisher L., Burke J., Fanucchi S., Sewell B.T., Fernandes M., Dirr H.W._x005F_x005F_x000D_Acta Crystallogr. F 66:776-780(2010) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.75 ANGSTROMS) OF MUTANTS ALA-71 AND VAL-71 IN COMPLEX WITH S-HEXYLGLUTATHIONE, FUNCTION, CATALYTIC ACTIVITY, MUTAGENESIS OF ILE-71. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 24.7 pg/mL

Gsta1 ELISA Kit (Rat) (OKCD01529)

OKCD01529 96 Wells
EUR 818
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.133 ng/mL

GSTA1 ELISA Kit (Human) (OKBB01139)

OKBB01139 96 Wells
EUR 505
Description: Description of target: GSTA encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

GSTA1 ELISA Kit (Human) (OKEH08708)

OKEH08708 96 Wells
EUR 896
Description: Description of target: This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 35pg/mL

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Phe222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), APC-Cy7

  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTa1 (Ala2~Gln223)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody (FITC)

  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody (FITC)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody (FITC)

  • EUR 467.00
  • EUR 244.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody (Biotin)

  • EUR 425.00
  • EUR 230.00
  • EUR 1191.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody (Biotin)

  • EUR 425.00
  • EUR 230.00
  • EUR 1219.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-GSTA1/A2/A3/A4/A5 Biotinylated Antibody

A01462-Biotin 50ug/vial
EUR 294

GSTA1 sgRNA CRISPR Lentivector set (Human)

K0912601 3 x 1.0 ug
EUR 339

Gsta1 sgRNA CRISPR Lentivector set (Mouse)

K3344401 3 x 1.0 ug
EUR 339

pCDH-CMV-GSTA1-EF1-copGFP Plasmid

PVT16093 2 ug
EUR 325

Mouse Glutathione S-Transferase A1 (GSTA1) Antibody (Biotin Conjugate)

32145-05121 150 ug
EUR 369

Glutathione S Transferase Alpha 1 (GSTa1) Monoclonal Antibody (Human)

  • EUR 241.00
  • EUR 2417.00
  • EUR 604.00
  • EUR 301.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala2~Phe222
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Glutathione S Transferase Alpha 1 (GSTa1)

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC


GSTA1 Rabbit Polyclonal Antibody