GCM2 Rabbit Polyclonal Antibody
 GCM2 Polyclonal Antibody |
|
ABP58621-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GCM2 protein at amino acid sequence of 21-70
- Applications tips:
|
|
Description: A polyclonal antibody for detection of GCM2 from Human, Mouse, Rat. This GCM2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GCM2 protein at amino acid sequence of 21-70 |
GCM2 Polyclonal Antibody |
|
46909-100ul |
SAB |
100ul |
EUR 252 |
GCM2 Polyclonal Antibody |
|
46909-50ul |
SAB |
50ul |
EUR 187 |
 GCM2 antibody |
|
70R-17446 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal GCM2 antibody |
GCM2 antibody |
|
70R-13412 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal GCM2 antibody |
 GCM2 Antibody |
|
1-CSB-PA725603 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against GCM2. Recognizes GCM2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
GCM2 Antibody |
|
1-CSB-PA009324GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against GCM2. Recognizes GCM2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
GCM2 Antibody |
|
1-CSB-PA009324LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against GCM2. Recognizes GCM2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
 Polyclonal GCM2 Antibody - N-terminal region |
|
APR01856G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GCM2 - N-terminal region. This antibody is tested and proven to work in the following applications: |
 anti- GCM2 antibody |
|
FNab03388 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: glial cells missing homolog 2(Drosophila)
- Uniprot ID: O75603
- Gene ID: 9247
- Research Area: Metabolism, Developmental biology
|
|
Description: Antibody raised against GCM2 |
 Anti-GCM2 antibody |
|
STJ99332 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to GCM2. |
 GCM2 siRNA |
|
20-abx917694 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GCM2 siRNA |
|
20-abx917695 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 GCM2 Antibody, HRP conjugated |
|
1-CSB-PA009324LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against GCM2. Recognizes GCM2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 GCM2 Antibody, FITC conjugated |
|
1-CSB-PA009324LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against GCM2. Recognizes GCM2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 GCM2 Antibody, Biotin conjugated |
|
1-CSB-PA009324LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against GCM2. Recognizes GCM2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 GCM2 cloning plasmid |
|
CSB-CL009324HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1521
- Sequence: atgccggcggccgcggtgcaggaagcggtcggcgtgtgctcctacgggatgcagctcagctgggacatcaacgatccgcagatgcctcaggagctggccctctttgaccaattccgagagtggcctgacggctatgtgcgcttcatctacagcagcgatgagaagaaggcacagc
- Show more
|
|
Description: A cloning plasmid for the GCM2 gene. |
 Mouse GCM2 shRNA Plasmid |
|
20-abx979848 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human GCM2 shRNA Plasmid |
|
20-abx956122 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) GCM2 Recombinant Protein (Human) |
|
RP039427 |
ABM |
100 ug |
Ask for price |
) GCM2 Recombinant Protein (Rat) |
|
RP202385 |
ABM |
100 ug |
Ask for price |
) GCM2 Recombinant Protein (Mouse) |
|
RP136151 |
ABM |
100 ug |
Ask for price |
 ELISA kit) Rabbit Chorion specific transcription factor GCMb(GCM2) ELISA kit |
|
E04C2295-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Chorion specific transcription factor GCMb(GCM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Chorion specific transcription factor GCMb(GCM2) ELISA kit |
|
E04C2295-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Chorion specific transcription factor GCMb(GCM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Chorion specific transcription factor GCMb(GCM2) ELISA kit |
|
E04C2295-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Chorion specific transcription factor GCMb(GCM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) Chorion-Specific Transcription Factor GCMb (GCM2) Antibody |
|
20-abx112725 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chorion-Specific Transcription Factor GCMb (GCM2) Antibody |
|
abx122499-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Chorion-Specific Transcription Factor GCMb (GCM2) Antibody |
|
20-abx329808 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chorion-Specific Transcription Factor GCMb (GCM2) Antibody |
|
20-abx318752 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Chorion-Specific Transcription Factor GCMb (GCM2) Antibody |
|
abx233388-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 (pORF)) Gcm2 ORF Vector (Rat) (pORF) |
|
ORF067463 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Gcm2 ORF Vector (Mouse) (pORF) |
|
ORF045385 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) GCM2 ORF Vector (Human) (pORF) |
|
ORF013143 |
ABM |
1.0 ug DNA |
EUR 354 |
 Antibody (HRP)) Chorion-Specific Transcription Factor GCMb (GCM2) Antibody (HRP) |
|
20-abx315747 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Chorion-Specific Transcription Factor GCMb (GCM2) Antibody (FITC) |
|
20-abx315748 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Chorion-Specific Transcription Factor GCMb (GCM2) Antibody (Biotin) |
|
20-abx315749 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) Gcm2 sgRNA CRISPR Lentivector set (Mouse) |
|
K4052201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) GCM2 sgRNA CRISPR Lentivector set (Human) |
|
K0847401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Gcm2 sgRNA CRISPR Lentivector set (Rat) |
|
K6729401 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Gcm2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4052202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Gcm2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4052203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Gcm2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4052204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) GCM2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0847402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) GCM2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0847403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) GCM2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0847404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Gcm2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6729402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Gcm2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6729403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Gcm2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6729404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) GCM2 Protein Vector (Human) (pPB-C-His) |
|
PV052569 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) GCM2 Protein Vector (Human) (pPB-N-His) |
|
PV052570 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) GCM2 Protein Vector (Human) (pPM-C-HA) |
|
PV052571 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) GCM2 Protein Vector (Human) (pPM-C-His) |
|
PV052572 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) GCM2 Protein Vector (Rat) (pPB-C-His) |
|
PV269850 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) GCM2 Protein Vector (Rat) (pPB-N-His) |
|
PV269851 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) GCM2 Protein Vector (Rat) (pPM-C-HA) |
|
PV269852 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) GCM2 Protein Vector (Rat) (pPM-C-His) |
|
PV269853 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) GCM2 Protein Vector (Mouse) (pPB-C-His) |
|
PV181538 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) GCM2 Protein Vector (Mouse) (pPB-N-His) |
|
PV181539 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) GCM2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV181540 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) GCM2 Protein Vector (Mouse) (pPM-C-His) |
|
PV181541 |
ABM |
500 ng |
EUR 603 |
 Gcm2 3'UTR Luciferase Stable Cell Line |
|
TU205007 |
ABM |
1.0 ml |
Ask for price |
 Gcm2 3'UTR GFP Stable Cell Line |
|
TU156974 |
ABM |
1.0 ml |
Ask for price |
 GCM2 3'UTR Luciferase Stable Cell Line |
|
TU008682 |
ABM |
1.0 ml |
EUR 1394 |
Gcm2 3'UTR Luciferase Stable Cell Line |
|
TU106974 |
ABM |
1.0 ml |
Ask for price |
 GCM2 3'UTR GFP Stable Cell Line |
|
TU058682 |
ABM |
1.0 ml |
EUR 1394 |
Gcm2 3'UTR GFP Stable Cell Line |
|
TU255007 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) GCM2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV624049 |
ABM |
1.0 ug DNA |
EUR 682 |
GCM2 Rabbit Polyclonal Antibody
