FHL3 Rabbit Polyclonal Antibody
FHL3 Rabbit pAb |
A8679-100ul |
Abclonal |
100 ul |
EUR 308 |
FHL3 Rabbit pAb |
A8679-200ul |
Abclonal |
200 ul |
EUR 459 |
FHL3 Rabbit pAb |
A8679-20ul |
Abclonal |
20 ul |
EUR 183 |
FHL3 Rabbit pAb |
A8679-50ul |
Abclonal |
50 ul |
EUR 223 |
FHL3 antibody |
70R-49746 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal FHL3 antibody |
FHL3 antibody |
70R-8913 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal FHL3 antibody |
FHL3 Antibody |
36483-100ul |
SAB |
100ul |
EUR 252 |
FHL3 antibody |
70R-17303 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal FHL3 antibody |
FHL3 Antibody |
DF8826 |
Affbiotech |
200ul |
EUR 304 |
Description: FHL3 Antibody detects endogenous levels of total FHL3. |
FHL3 Antibody |
1-CSB-PA977533 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200 |
FHL3 Antibody |
1-CSB-PA985521 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
FHL3 Antibody |
1-CSB-PA618796ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
FHL3 Antibody |
1-CSB-PA618796ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
FHL3 Antibody |
1-CSB-PA008665GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Polyclonal Goat Anti-FHL3 / SLIM2 Antibody |
APG00126G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-FHL3 / SLIM2 . This antibody is tested and proven to work in the following applications: |
FHL3 Conjugated Antibody |
C36483 |
SAB |
100ul |
EUR 397 |
anti- FHL3 antibody |
FNab03112 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: four and a half LIM domains 3
- Uniprot ID: Q13643
- Gene ID: 2275
- Research Area: Developmental biology
|
Description: Antibody raised against FHL3 |
Anti-FHL3 Antibody |
PB10064 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-FHL3 antibody |
STJ111377 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of a family of proteins containing a four-and-a-half LIM domain, which is a highly conserved double zinc finger motif. The encoded protein has been shown to interact with the cancer developmental regulators SMAD2, SMAD3, and SMAD4, the skeletal muscle myogenesis protein MyoD, and the high-affinity IgE beta chain regulator MZF-1. This protein may be involved in tumor suppression, repression of MyoD expression, and repression of IgE receptor expression. Two transcript variants encoding different isoforms have been found for this gene. |
Anti-FHL3 antibody |
STJ190217 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FHL3 |
FHL3 siRNA |
20-abx916878 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FHL3 siRNA |
20-abx916879 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FHL3 cloning plasmid |
CSB-CL618796HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 519
- Sequence: atgcctgggtcccggaagctggaatatggaggccagacatggcatgagcactgcttcctgtgcagtggctgtgaacagccactgggctcccgttcttttgtgcccgacaagggtgctcactactgcgtgccctgctatgagaacaagtttgctcctcgctgcgcccgctgcagcaa
- Show more
|
Description: A cloning plasmid for the FHL3 gene. |
FHL3 cloning plasmid |
CSB-CL618796HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 843
- Sequence: atgagcgagtcatttgactgtgcaaaatgcaacgagtccctgtatggacgcaagtacatccagacagacagcggcccctactgtgtgccctgctatgacaatacctttgccaacacctgtgctgagtgccagcagcttatcgggcatgactcgagggagctgttctatgaagaccg
- Show more
|
Description: A cloning plasmid for the FHL3 gene. |
FHL3 Blocking Peptide |
20-abx062621 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FHL3 Blocking Peptide |
33R-3837 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FHL3 antibody, catalog no. 70R-8913 |
FHL3 Blocking Peptide |
DF8826-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-FHL3 (2C10) |
YF-MA13026 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FHL3 |
FHL3 protein (His tag) |
80R-3544 |
Fitzgerald |
50 ug |
EUR 327 |
Description: Purified recombinant FHL3 protein (His tag) |
Mouse FHL3 shRNA Plasmid |
20-abx970340 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human FHL3 shRNA Plasmid |
20-abx951592 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FHL3 Recombinant Protein (Human) |
RP012172 |
ABM |
100 ug |
Ask for price |
FHL3 Recombinant Protein (Human) |
RP012175 |
ABM |
100 ug |
Ask for price |
FHL3 Recombinant Protein (Rat) |
RP201401 |
ABM |
100 ug |
Ask for price |
FHL3 Recombinant Protein (Mouse) |
RP134603 |
ABM |
100 ug |
Ask for price |
FHL3 ORF Vector (Human) (pORF) |
ORF004058 |
ABM |
1.0 ug DNA |
EUR 95 |
FHL3 ORF Vector (Human) (pORF) |
ORF004059 |
ABM |
1.0 ug DNA |
EUR 95 |
Fhl3 ORF Vector (Rat) (pORF) |
ORF067135 |
ABM |
1.0 ug DNA |
EUR 506 |
Fhl3 ORF Vector (Mouse) (pORF) |
ORF044869 |
ABM |
1.0 ug DNA |
EUR 506 |
FHL3 sgRNA CRISPR Lentivector set (Human) |
K0782001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fhl3 sgRNA CRISPR Lentivector set (Mouse) |
K4460501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fhl3 sgRNA CRISPR Lentivector set (Rat) |
K6174801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Four And A Half LIM Domains 3 (FHL3) Antibody |
20-abx123606 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains 3 (FHL3) Antibody |
20-abx112586 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains 3 (FHL3) Antibody |
20-abx009262 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains 3 (FHL3) Antibody |
20-abx321199 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains 3 (FHL3) Antibody |
20-abx322016 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains 3 (FHL3) Antibody |
abx215361-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains 3 (FHL3) Antibody |
abx430147-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Four And A Half LIM Domains 3 (FHL3) Antibody |
20-abx210835 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains 3 (FHL3) Antibody |
20-abx212508 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains 3 (FHL3) Antibody |
abx233112-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
FHL3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0782002 |
ABM |
1.0 ug DNA |
EUR 154 |
FHL3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0782003 |
ABM |
1.0 ug DNA |
EUR 154 |
FHL3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0782004 |
ABM |
1.0 ug DNA |
EUR 154 |
Fhl3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4460502 |
ABM |
1.0 ug DNA |
EUR 154 |
Fhl3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4460503 |
ABM |
1.0 ug DNA |
EUR 154 |
Fhl3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4460504 |
ABM |
1.0 ug DNA |
EUR 154 |
Fhl3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6174802 |
ABM |
1.0 ug DNA |
EUR 154 |
Fhl3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6174803 |
ABM |
1.0 ug DNA |
EUR 154 |
Fhl3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6174804 |
ABM |
1.0 ug DNA |
EUR 154 |
FHL3 Protein Vector (Rat) (pPB-C-His) |
PV268538 |
ABM |
500 ng |
EUR 603 |
FHL3 Protein Vector (Rat) (pPB-N-His) |
PV268539 |
ABM |
500 ng |
EUR 603 |
FHL3 Protein Vector (Rat) (pPM-C-HA) |
PV268540 |
ABM |
500 ng |
EUR 603 |
FHL3 Protein Vector (Rat) (pPM-C-His) |
PV268541 |
ABM |
500 ng |
EUR 603 |
FHL3 Protein Vector (Mouse) (pPB-C-His) |
PV179474 |
ABM |
500 ng |
EUR 603 |
FHL3 Protein Vector (Mouse) (pPB-N-His) |
PV179475 |
ABM |
500 ng |
EUR 603 |
FHL3 Protein Vector (Mouse) (pPM-C-HA) |
PV179476 |
ABM |
500 ng |
EUR 603 |
FHL3 Protein Vector (Mouse) (pPM-C-His) |
PV179477 |
ABM |
500 ng |
EUR 603 |
FHL3 Protein Vector (Human) (pPB-C-His) |
PV016229 |
ABM |
500 ng |
EUR 329 |
FHL3 Protein Vector (Human) (pPB-N-His) |
PV016230 |
ABM |
500 ng |
EUR 329 |
FHL3 Protein Vector (Human) (pPM-C-HA) |
PV016231 |
ABM |
500 ng |
EUR 329 |
FHL3 Protein Vector (Human) (pPM-C-His) |
PV016232 |
ABM |
500 ng |
EUR 329 |
FHL3 Protein Vector (Human) (pPB-C-His) |
PV016233 |
ABM |
500 ng |
EUR 329 |
FHL3 Protein Vector (Human) (pPB-N-His) |
PV016234 |
ABM |
500 ng |
EUR 329 |
FHL3 Protein Vector (Human) (pPM-C-HA) |
PV016235 |
ABM |
500 ng |
EUR 329 |
FHL3 Protein Vector (Human) (pPM-C-His) |
PV016236 |
ABM |
500 ng |
EUR 329 |
Fhl3 3'UTR Luciferase Stable Cell Line |
TU204634 |
ABM |
1.0 ml |
Ask for price |
Fhl3 3'UTR GFP Stable Cell Line |
TU156570 |
ABM |
1.0 ml |
Ask for price |
FHL3 3'UTR Luciferase Stable Cell Line |
TU007969 |
ABM |
1.0 ml |
EUR 1394 |
Fhl3 3'UTR Luciferase Stable Cell Line |
TU106570 |
ABM |
1.0 ml |
Ask for price |
FHL3 3'UTR GFP Stable Cell Line |
TU057969 |
ABM |
1.0 ml |
EUR 1394 |
Fhl3 3'UTR GFP Stable Cell Line |
TU254634 |
ABM |
1.0 ml |
Ask for price |
FHL3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV710163 |
ABM |
1.0 ug DNA |
EUR 316 |
FHL3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV710167 |
ABM |
1.0 ug DNA |
EUR 316 |
FHL3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV710168 |
ABM |
1.0 ug DNA |
EUR 316 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
FHL3 Rabbit Polyclonal Antibody