EYA1/EYA4 Rabbit Polyclonal Antibody
EYA1/EYA4 Polyclonal Antibody |
ABP58510-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human EYA1/EYA4 protein at amino acid sequence of 271-320
- Applications tips:
|
Description: A polyclonal antibody for detection of EYA1/EYA4 from Human, Mouse. This EYA1/EYA4 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EYA1/EYA4 protein at amino acid sequence of 271-320 |
EYA1/EYA4 Polyclonal Antibody |
ABP58510-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human EYA1/EYA4 protein at amino acid sequence of 271-320
- Applications tips:
|
Description: A polyclonal antibody for detection of EYA1/EYA4 from Human, Mouse. This EYA1/EYA4 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EYA1/EYA4 protein at amino acid sequence of 271-320 |
EYA1 / EYA4 Antibody |
20-abx325358 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EYA1/EYA4 Antibody |
1-CSB-PA109941 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against EYA1/EYA4. Recognizes EYA1/EYA4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000 |
Anti-EYA1/EYA4 antibody |
STJ99013 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to EYA1/EYA4. |
EYA4 Polyclonal Antibody |
A69491 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
EYA4 Polyclonal Antibody |
31726-100ul |
SAB |
100ul |
EUR 252 |
EYA4 Polyclonal Antibody |
31726-50ul |
SAB |
50ul |
EUR 187 |
EYA1 Polyclonal Antibody |
A69151 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
EYA1 Polyclonal Antibody |
31720-100ul |
SAB |
100ul |
EUR 252 |
EYA1 Polyclonal Antibody |
31720-50ul |
SAB |
50ul |
EUR 187 |
EYA4 Rabbit pAb |
A9638-100ul |
Abclonal |
100 ul |
EUR 308 |
EYA4 Rabbit pAb |
A9638-200ul |
Abclonal |
200 ul |
EUR 459 |
EYA4 Rabbit pAb |
A9638-20ul |
Abclonal |
20 ul |
Ask for price |
EYA4 Rabbit pAb |
A9638-50ul |
Abclonal |
50 ul |
Ask for price |
EYA4 Polyclonal Conjugated Antibody |
C31726 |
SAB |
100ul |
EUR 397 |
EYA1 Rabbit pAb |
A9534-100ul |
Abclonal |
100 ul |
EUR 308 |
EYA1 Rabbit pAb |
A9534-200ul |
Abclonal |
200 ul |
EUR 459 |
EYA1 Rabbit pAb |
A9534-20ul |
Abclonal |
20 ul |
EUR 183 |
EYA1 Rabbit pAb |
A9534-50ul |
Abclonal |
50 ul |
EUR 223 |
EYA1 Polyclonal Conjugated Antibody |
C31720 |
SAB |
100ul |
EUR 397 |
EYA4 Antibody |
1-CSB-PA007909LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EYA4. Recognizes EYA4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:200-1:500 |
EYA1 Antibody |
1-CSB-PA857862LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EYA1. Recognizes EYA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:50-1:200 |
Polyclonal EYA4 Antibody (C-term) |
APR11886G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EYA4 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal EYA4 Antibody (N-Term) |
APR11887G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human EYA4 (N-Term). This antibody is tested and proven to work in the following applications: |
Polyclonal EYA4 Antibody (N-Terminus) |
APR11888G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human EYA4 (N-Terminus). This antibody is tested and proven to work in the following applications: |
EYA4 Polyclonal Antibody, HRP Conjugated |
A69492 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
EYA4 Polyclonal Antibody, FITC Conjugated |
A69493 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
EYA4 Polyclonal Antibody, Biotin Conjugated |
A69494 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
Polyclonal EYA1 antibody - middle region |
APR00561G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EYA1 - middle region. This antibody is tested and proven to work in the following applications: |
Polyclonal Goat Anti-EYA1 Antibody |
APG00375G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-EYA1 . This antibody is tested and proven to work in the following applications: |
EYA1 Polyclonal Antibody, HRP Conjugated |
A69152 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
EYA1 Polyclonal Antibody, FITC Conjugated |
A69153 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
EYA1 Polyclonal Antibody, Biotin Conjugated |
A69154 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
anti- EYA4 antibody |
FNab02916 |
FN Test |
100µg |
EUR 585 |
- Immunogen: eyes absent homolog 4(Drosophila)
- Uniprot ID: O95677
- Gene ID: 2070
- Research Area: Neuroscience, Cardiovascular, Metabolism, Developmental biology
|
Description: Antibody raised against EYA4 |
Anti-EYA4 antibody |
STJ111772 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator through its protein phosphatase activity, and it may be important for eye development, and for continued function of the mature organ of Corti. Mutations in this gene are associated with postlingual, progressive, autosomal dominant hearing loss at the deafness, autosomal dominant non-syndromic sensorineural 10 locus. The encoded protein is also a putative oncogene that mediates DNA repair, apoptosis, and innate immunity following DNA damage, cellular damage, and viral attack. Defects in this gene are also associated with dilated cardiomyopathy 1J. Alternative splicing results in multiple transcript variants encoding distinct isoforms. |
anti- EYA1 antibody |
FNab02913 |
FN Test |
100µg |
EUR 585 |
- Immunogen: eyes absent homolog 1(Drosophila)
- Uniprot ID: Q99502
- Gene ID: 2138
- Research Area: Neuroscience, Metabolism, Developmental biology
|
Description: Antibody raised against EYA1 |
Anti-EYA1 antibody |
STJ113653 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may play a role in the developing kidney, branchial arches, eye, and ear. Mutations of this gene have been associated with branchiootorenal dysplasia syndrome, branchiootic syndrome, and sporadic cases of congenital cataracts and ocular anterior segment anomalies. A similar protein in mice can act as a transcriptional activator. Alternatively spliced transcript variants have been identified for this gene. |
EYA4 siRNA |
20-abx915852 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EYA4 siRNA |
20-abx915853 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EYA1 siRNA |
20-abx915846 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EYA1 siRNA |
20-abx915847 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-EYA1 |
YF-PA23680 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to EYA1 |
EYA4 Antibody, HRP conjugated |
1-CSB-PA007909LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EYA4. Recognizes EYA4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
EYA4 Antibody, FITC conjugated |
1-CSB-PA007909LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EYA4. Recognizes EYA4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
EYA4 Antibody, Biotin conjugated |
1-CSB-PA007909LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EYA4. Recognizes EYA4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
EYA1 Antibody, HRP conjugated |
1-CSB-PA857862LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EYA1. Recognizes EYA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
EYA1 Antibody, FITC conjugated |
1-CSB-PA857862LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EYA1. Recognizes EYA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
EYA1 Antibody, Biotin conjugated |
1-CSB-PA857862LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EYA1. Recognizes EYA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
EYA4 cloning plasmid |
CSB-CL007909HU-10ug |
Cusabio |
10ug |
EUR 628 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1851
- Sequence: atggaagactcccaggatttaaatgaacaatcagtaaagaaaacgtgcacagaatcagatgtttcacaatctcagaattccaggtctatggaaatgcaggacctagcaagtcctcatactcttgttggaggtggtgatactccaggtagctccaaactggaaaaatctaatctca
- Show more
|
Description: A cloning plasmid for the EYA4 gene. |
EYA1 Blocking Peptide |
20-abx161092 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EYA1 cloning plasmid |
CSB-CL857862HU-10ug |
Cusabio |
10ug |
EUR 608 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1779
- Sequence: ATGGAAATGCAGGATCTAACCAGCCCGCATAGCCGTCTGAGTGGTAGTAGTGAATCCCCCAGTGGCCCCAAACTCGGTAACTCTCATATAAATAGTAATTCCATGACTCCCAATGGCACCGAAGTTAAAACAGAGCCAATGAGCAGCAGTGAAACAGCTTCAACGACAGCCGACG
- Show more
|
Description: A cloning plasmid for the EYA1 gene. |
Rabbit Anti-Human eyes absent homolog 1 (EYA1) (EYA1- symmetric dimethyl arginine) IgG (aff pure) |
AB-23020-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
Rabbit Anti-Human eyes absent homolog 1 (EYA1) (EYA1- symmetric dimethyl arginine) IgG (aff pure) |
AB-23021-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
Rabbit Anti-Human eyes absent homolog 1 (EYA1) (EYA1- symmetric dimethyl arginine) IgG (aff pure) |
AB-23022-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
Human EYA4 shRNA Plasmid |
20-abx951445 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse EYA4 shRNA Plasmid |
20-abx970253 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EYA4 Recombinant Protein (Human) |
RP011098 |
ABM |
100 ug |
Ask for price |
EYA4 Recombinant Protein (Mouse) |
RP132584 |
ABM |
100 ug |
Ask for price |
Eyes Absent Homolog 4 (EYA4) Antibody |
20-abx124314 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eyes Absent Homolog 4 (EYA4) Antibody |
abx034330-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Eyes Absent Homolog 4 (EYA4) Antibody |
abx034330-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Eyes Absent Homolog 4 (EYA4) Antibody |
20-abx334389 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eyes Absent Homolog 4 (EYA4) Antibody |
abx431239-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Eyes Absent Homolog 4 (EYA4) Antibody |
abx232916-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Human EYA1 shRNA Plasmid |
20-abx951487 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse EYA1 shRNA Plasmid |
20-abx970250 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EYA1 Recombinant Protein (Human) |
RP038833 |
ABM |
100 ug |
Ask for price |
EYA1 Recombinant Protein (Mouse) |
RP132566 |
ABM |
100 ug |
Ask for price |
EYA1 Recombinant Protein (Mouse) |
RP132569 |
ABM |
100 ug |
Ask for price |
Eyes Absent Homolog 1 (EYA1) Antibody |
20-abx123948 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Eyes Absent Homolog 1 (EYA1) Antibody |
20-abx121092 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Eyes Absent Homolog 1 (EYA1) Antibody |
abx026818-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Eyes Absent Homolog 1 (EYA1) Antibody |
abx026818-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Eyes Absent Homolog 1 (EYA1) Antibody |
20-abx333709 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eyes Absent Homolog 1 (EYA1) Antibody |
abx431237-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Eyes Absent Homolog 1 (EYA1) Antibody |
abx232913-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Eyes Absent Homolog 4 (EYA4) Antibody (HRP) |
20-abx335655 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eyes Absent Homolog 4 (EYA4) Antibody (FITC) |
20-abx335656 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eyes Absent Homolog 4 (EYA4) Antibody (Biotin) |
20-abx335657 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
EYA4 ORF Vector (Human) (pORF) |
ORF003700 |
ABM |
1.0 ug DNA |
EUR 95 |
Eya4 ORF Vector (Mouse) (pORF) |
ORF044196 |
ABM |
1.0 ug DNA |
EUR 506 |
Human eyes absent homolog 1 (EYA1) control (EYA1- symmetric dimethyl arginine) peptide |
AB-23020-P |
Alpha Diagnostics |
100ug |
EUR 164 |
Human eyes absent homolog 1 (EYA1) control (EYA1- symmetric dimethyl arginine) peptide |
AB-23021-P |
Alpha Diagnostics |
100ug |
EUR 164 |
Human eyes absent homolog 1 (EYA1) control (EYA1- symmetric dimethyl arginine) peptide |
AB-23022-P |
Alpha Diagnostics |
100ug |
EUR 164 |
Eyes Absent Homolog 1 (EYA1) Antibody (HRP) |
20-abx335652 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eyes Absent Homolog 1 (EYA1) Antibody (FITC) |
20-abx335653 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eyes Absent Homolog 1 (EYA1) Antibody (Biotin) |
20-abx335654 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eya1 ORF Vector (Mouse) (pORF) |
ORF044190 |
ABM |
1.0 ug DNA |
EUR 1572 |
Eya1 ORF Vector (Mouse) (pORF) |
ORF044191 |
ABM |
1.0 ug DNA |
EUR 506 |
EYA1 ORF Vector (Human) (pORF) |
ORF012945 |
ABM |
1.0 ug DNA |
EUR 95 |
EYA4 sgRNA CRISPR Lentivector set (Human) |
K0705601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Eya4 sgRNA CRISPR Lentivector set (Mouse) |
K3818701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Eya1 sgRNA CRISPR Lentivector set (Mouse) |
K3853101 |
ABM |
3 x 1.0 ug |
EUR 339 |
EYA1 sgRNA CRISPR Lentivector set (Human) |
K0705301 |
ABM |
3 x 1.0 ug |
EUR 339 |
EYA4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0705602 |
ABM |
1.0 ug DNA |
EUR 154 |
EYA4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0705603 |
ABM |
1.0 ug DNA |
EUR 154 |
EYA4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0705604 |
ABM |
1.0 ug DNA |
EUR 154 |
Eya4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3818702 |
ABM |
1.0 ug DNA |
EUR 154 |
Eya4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3818703 |
ABM |
1.0 ug DNA |
EUR 154 |
Eya4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3818704 |
ABM |
1.0 ug DNA |
EUR 154 |
EYA4 Protein Vector (Mouse) (pPB-C-His) |
PV176782 |
ABM |
500 ng |
EUR 603 |
EYA4 Protein Vector (Mouse) (pPB-N-His) |
PV176783 |
ABM |
500 ng |
EUR 603 |
EYA4 Protein Vector (Mouse) (pPM-C-HA) |
PV176784 |
ABM |
500 ng |
EUR 603 |
EYA4 Protein Vector (Mouse) (pPM-C-His) |
PV176785 |
ABM |
500 ng |
EUR 603 |
EYA4 Protein Vector (Human) (pPB-C-His) |
PV014797 |
ABM |
500 ng |
EUR 329 |
EYA4 Protein Vector (Human) (pPB-N-His) |
PV014798 |
ABM |
500 ng |
EUR 329 |
EYA4 Protein Vector (Human) (pPM-C-HA) |
PV014799 |
ABM |
500 ng |
EUR 329 |
EYA4 Protein Vector (Human) (pPM-C-His) |
PV014800 |
ABM |
500 ng |
EUR 329 |
Eya4 3'UTR Luciferase Stable Cell Line |
TU204176 |
ABM |
1.0 ml |
Ask for price |
Eya4 3'UTR GFP Stable Cell Line |
TU156036 |
ABM |
1.0 ml |
Ask for price |
EYA4 3'UTR Luciferase Stable Cell Line |
TU007152 |
ABM |
1.0 ml |
EUR 4617 |
Eya4 3'UTR Luciferase Stable Cell Line |
TU106036 |
ABM |
1.0 ml |
Ask for price |
EYA4 3'UTR GFP Stable Cell Line |
TU057152 |
ABM |
1.0 ml |
EUR 4617 |
Eya4 3'UTR GFP Stable Cell Line |
TU254176 |
ABM |
1.0 ml |
Ask for price |
Eya1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3853102 |
ABM |
1.0 ug DNA |
EUR 154 |
Eya1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3853103 |
ABM |
1.0 ug DNA |
EUR 154 |
Eya1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3853104 |
ABM |
1.0 ug DNA |
EUR 154 |
EYA1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0705302 |
ABM |
1.0 ug DNA |
EUR 154 |
EYA1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0705303 |
ABM |
1.0 ug DNA |
EUR 154 |
EYA1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0705304 |
ABM |
1.0 ug DNA |
EUR 154 |
EYA1 Protein Vector (Human) (pPB-C-His) |
PV051777 |
ABM |
500 ng |
EUR 481 |
EYA1 Protein Vector (Human) (pPB-N-His) |
PV051778 |
ABM |
500 ng |
EUR 481 |
EYA1 Protein Vector (Human) (pPM-C-HA) |
PV051779 |
ABM |
500 ng |
EUR 481 |
EYA1 Protein Vector (Human) (pPM-C-His) |
PV051780 |
ABM |
500 ng |
EUR 481 |
EYA1 Protein Vector (Mouse) (pPB-C-His) |
PV176758 |
ABM |
500 ng |
EUR 2403 |
EYA1 Protein Vector (Mouse) (pPB-N-His) |
PV176759 |
ABM |
500 ng |
EUR 2403 |
EYA1 Protein Vector (Mouse) (pPM-C-HA) |
PV176760 |
ABM |
500 ng |
EUR 2403 |
EYA1 Protein Vector (Mouse) (pPM-C-His) |
PV176761 |
ABM |
500 ng |
EUR 2403 |
EYA1 Protein Vector (Mouse) (pPB-C-His) |
PV176762 |
ABM |
500 ng |
EUR 603 |
EYA1 Protein Vector (Mouse) (pPB-N-His) |
PV176763 |
ABM |
500 ng |
EUR 603 |
EYA1 Protein Vector (Mouse) (pPM-C-HA) |
PV176764 |
ABM |
500 ng |
EUR 603 |
EYA1 Protein Vector (Mouse) (pPM-C-His) |
PV176765 |
ABM |
500 ng |
EUR 603 |
Eya1 3'UTR Luciferase Stable Cell Line |
TU204173 |
ABM |
1.0 ml |
Ask for price |
Eya1 3'UTR GFP Stable Cell Line |
TU156033 |
ABM |
1.0 ml |
Ask for price |
EYA1 3'UTR Luciferase Stable Cell Line |
TU007149 |
ABM |
1.0 ml |
EUR 1521 |
Eya1 3'UTR Luciferase Stable Cell Line |
TU106033 |
ABM |
1.0 ml |
Ask for price |
EYA1 3'UTR GFP Stable Cell Line |
TU057149 |
ABM |
1.0 ml |
EUR 1521 |
Eya1 3'UTR GFP Stable Cell Line |
TU254173 |
ABM |
1.0 ml |
Ask for price |
Chicken Eyes absent homolog 4, EYA4 ELISA KIT |
ELI-26939c |
Lifescience Market |
96 Tests |
EUR 928 |
Human Eyes absent homolog 4, EYA4 ELISA KIT |
ELI-26996h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Eyes absent homolog 4, Eya4 ELISA KIT |
ELI-47674m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Eyes Absent Homolog 4 (EYA4) ELISA Kit |
abx387235-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Chicken Eyes absent homolog 1, EYA1 ELISA KIT |
ELI-09973c |
Lifescience Market |
96 Tests |
EUR 928 |
Human Eyes absent homolog 1, EYA1 ELISA KIT |
ELI-09974h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Eyes absent homolog 1, Eya1 ELISA KIT |
ELI-31369m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Eyes Absent Homolog 1 (EYA1) ELISA Kit |
abx387232-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
EYA1/EYA4 Rabbit Polyclonal Antibody