EPS8 Rabbit Polyclonal Antibody

EPS8 Rabbit Polyclonal Antibody


EPS8 Polyclonal Antibody

ABP58492-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EPS8 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of EPS8 from Human, Mouse. This EPS8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPS8 protein at amino acid sequence of 130-210

EPS8 Polyclonal Antibody

ABP58492-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EPS8 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of EPS8 from Human, Mouse. This EPS8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPS8 protein at amino acid sequence of 130-210

EPS8 Polyclonal Antibody

ABP58492-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EPS8 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of EPS8 from Human, Mouse. This EPS8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPS8 protein at amino acid sequence of 130-210

EPS8 Polyclonal Antibody

ES9052-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EPS8 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EPS8 Polyclonal Antibody

ES9052-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EPS8 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EPS8 Rabbit pAb

A14730-100ul 100 ul
EUR 308

EPS8 Rabbit pAb

A14730-200ul 200 ul
EUR 459

EPS8 Rabbit pAb

A14730-20ul 20 ul
EUR 183

EPS8 Rabbit pAb

A14730-50ul 50 ul
EUR 223

EPS8 Rabbit pAb

A8826-100ul 100 ul
EUR 308

EPS8 Rabbit pAb

A8826-200ul 200 ul
EUR 459

EPS8 Rabbit pAb

A8826-20ul 20 ul Ask for price

EPS8 Rabbit pAb

A8826-50ul 50 ul Ask for price

EPS8 Polyclonal Conjugated Antibody

C28687 100ul
EUR 397

EPS8 antibody

22105-100ul 100ul
EUR 390

EPS8 antibody

70R-17121 50 ul
EUR 435
Description: Rabbit polyclonal EPS8 antibody

EPS8 antibody

70R-12509 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal EPS8 antibody

EPS8 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EPS8. Recognizes EPS8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

EPS8 Antibody

DF8413 200ul
EUR 304
Description: EPS8 Antibody detects endogenous levels of total EPS8.

EPS8 antibody

70R-3683 50 ug
EUR 467
Description: Rabbit polyclonal EPS8 antibody raised against the middle region of EPS8

EPS8 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EPS8. Recognizes EPS8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EPS8 Antibody

ABD8413 100 ug
EUR 438

Polyclonal EPS8 Antibody (C-Term)

APG00422G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human EPS8 (C-Term). This antibody is tested and proven to work in the following applications:

anti- EPS8 antibody

FNab02819 100µg
EUR 585
  • Immunogen: epidermal growth factor receptor pathway substrate 8
  • Uniprot ID: Q12929
  • Gene ID: 2059
  • Research Area: Signal Transduction
Description: Antibody raised against EPS8

Anti-EPS8 antibody

PAab02819 100 ug
EUR 412

Anti-EPS8 antibody

STJ113588 100 µl
EUR 277
Description: This gene encodes a member of the EPS8 family. This protein contains one PH domain and one SH3 domain. It functions as part of the EGFR pathway, though its exact role has not been determined. Highly similar proteins in other organisms are involved in the transduction of signals from Ras to Rac and growth factor-mediated actin remodeling. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized.

Anti-EPS8 antibody

STJ116930 100 µl
EUR 277
Description: This gene encodes a member of the EPS8 family. This protein contains one PH domain and one SH3 domain. It functions as part of the EGFR pathway, though its exact role has not been determined. Highly similar proteins in other organisms are involved in the transduction of signals from Ras to Rac and growth factor-mediated actin remodeling. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized.

Anti-EPS8 antibody

STJ70422 100 µg
EUR 359

Anti-EPS8 antibody

STJ190210 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EPS8


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA11611 50 ug
EUR 363
Description: Mouse polyclonal to EPS8

EPS8 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EPS8. Recognizes EPS8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EPS8 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EPS8. Recognizes EPS8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EPS8 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EPS8. Recognizes EPS8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EPS8 Blocking Peptide

33R-9810 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EPS8 antibody, catalog no. 70R-3683

EPS8 Blocking Peptide

DF8413-BP 1mg
EUR 195

EPS8 cloning plasmid

CSB-CL615539HU-10ug 10ug
EUR 801
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2469
  • Sequence: atgaatggtcatatttctaatcatcccagtagttttggaatgtacccatctcagatgaatggctacggatcatcacctaccttttcccagacggacagagaacatggttcaaaaacaagtgcaaaggccctttatgaacaaaggaagaattatgcacgggacagtgtcagcagtg
  • Show more
Description: A cloning plasmid for the EPS8 gene.

EPS8 Like 3 (EPS8L3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

EPS8 Like 2 (EPS8L2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

EPS8 Like 3 (Eps8L3) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPS8 Like 2 (EPS8L2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

EPS8 Like 3 (EPS8L3) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

EPS8 Like 2 (EPS8L2) Antibody

abx031067-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

EPS8 Like 2 (EPS8L2) Antibody

abx031067-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

EPS8 Like 3 (EPS8L3) Antibody

abx033058-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

EPS8 Like 3 (EPS8L3) Antibody

abx033058-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

EPS8 Like 1 (EPS8L1) Antibody

abx028818-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

EPS8 Like 1 (EPS8L1) Antibody

abx028818-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

EPS8 Like 3 (EPS8L3) Antibody

abx330550-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

EPS8 Like 1 (EPS8L1) Antibody

abx331587-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

EPS8 Like 2 (EPS8L2) Antibody

abx331771-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

EPS8 Like 1 (EPS8L1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPS8 Like 2 (EPS8L2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPS8 Like 3 (EPS8L3) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPS8 Like 3 (EPS8L3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPS8 Like 2 (EPS8L2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPS8 Like 2 (EPS8L2) Antibody

abx232820-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Mouse Eps8 ELISA KIT

ELI-26890m 96 Tests
EUR 865


ELI-08314h 96 Tests
EUR 824


EF007491 96 Tests
EUR 689

Rat EPS8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EPS8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EPS8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EPS8 Recombinant Protein (Human)

RP010819 100 ug Ask for price

EPS8 Recombinant Protein (Mouse)

RP132056 100 ug Ask for price

EPS8 Like 3 (EPS8L3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPS8 Like 3 (EPS8L3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPS8 Like 3 (EPS8L3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPS8 Like 2 (EPS8L2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPS8 Like 2 (EPS8L2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPS8 Like 2 (EPS8L2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPS8 ORF Vector (Human) (pORF)

ORF003607 1.0 ug DNA
EUR 95

Eps8 ORF Vector (Mouse) (pORF)

ORF044020 1.0 ug DNA
EUR 506

EPS8 ELISA Kit (Human) (OKWB00223)

OKWB00223 96 Wells
EUR 572
Description: Description of target: Signaling adapter that controls various cellular protrusions by regulating actin cytoskeleton dynamics and architecture. Depending on its association with other signal transducers, can regulate different processes. Together with SOS1 and ABI1, forms a trimeric complex that participates in transduction of signals from Ras to Rac by activating the Rac-specific guanine nucleotide exchange factor (GEF) activity. Acts as a direct regulator of actin dynamics by binding actin filaments and has both barbed-end actin filament capping and actin bundling activities depending on the context. Displays barbed-end actin capping activity when associated with ABI1, thereby regulating actin-based motility process: capping activity is auto-inhibited and inhibition is relieved upon ABI1 interaction. Also shows actin bundling activity when associated with BAIAP2, enhancing BAIAP2-dependent membrane extensions and promoting filopodial protrusions. Involved in the regulation of processes such as axonal filopodia growth, stereocilia length, dendritic cell migration and cancer cell migration and invasion. Acts as a regulator of axonal filopodia formation in neurons: in the absence of neurotrophic factors, negatively regulates axonal filopodia formation via actin-capping activity. In contrast, it is phosphorylated in the presence of BDNF leading to inhibition of its actin-capping activity and stimulation of filopodia formation. Component of a complex with WHRN and MYO15A that localizes at stereocilia tips and is required for elongation of the stereocilia actin core. Indirectly involved in cell cycle progression; its degradation following ubiquitination being required during G2 phase to promote cell shape changes.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

EPS8 sgRNA CRISPR Lentivector set (Human)

K0689001 3 x 1.0 ug
EUR 339

Eps8 sgRNA CRISPR Lentivector set (Mouse)

K4413401 3 x 1.0 ug
EUR 339

Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody

abx033909-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody

abx033909-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody

abx431233-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody

abx232819-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

EPS8 sgRNA CRISPR Lentivector (Human) (Target 1)

K0689002 1.0 ug DNA
EUR 154

EPS8 sgRNA CRISPR Lentivector (Human) (Target 2)

K0689003 1.0 ug DNA
EUR 154

EPS8 sgRNA CRISPR Lentivector (Human) (Target 3)

K0689004 1.0 ug DNA
EUR 154

Eps8 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4413402 1.0 ug DNA
EUR 154

Eps8 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4413403 1.0 ug DNA
EUR 154

Eps8 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4413404 1.0 ug DNA
EUR 154

EPS8 Protein Vector (Mouse) (pPB-C-His)

PV176078 500 ng
EUR 1065

EPS8 Protein Vector (Mouse) (pPB-N-His)

PV176079 500 ng
EUR 1065

EPS8 Protein Vector (Mouse) (pPM-C-HA)

PV176080 500 ng
EUR 1065

EPS8 Protein Vector (Mouse) (pPM-C-His)

PV176081 500 ng
EUR 1065

EPS8 Protein Vector (Human) (pPB-C-His)

PV014425 500 ng
EUR 329

EPS8 Protein Vector (Human) (pPB-N-His)

PV014426 500 ng
EUR 329

EPS8 Protein Vector (Human) (pPM-C-HA)

PV014427 500 ng
EUR 329

EPS8 Protein Vector (Human) (pPM-C-His)

PV014428 500 ng
EUR 329

Eps8 3'UTR GFP Stable Cell Line

TU155895 1.0 ml Ask for price

Eps8 3'UTR Luciferase Stable Cell Line

TU105895 1.0 ml Ask for price

Eps8 3'UTR Luciferase Stable Cell Line

TU204052 1.0 ml Ask for price

Eps8 3'UTR GFP Stable Cell Line

TU254052 1.0 ml Ask for price

EPS8 3'UTR GFP Stable Cell Line

TU056979 1.0 ml
EUR 1394

EPS8 3'UTR Luciferase Stable Cell Line

TU006979 1.0 ml
EUR 1394

Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human EPS8 Like Protein 2 (EPS8L2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse EPS8 Like Protein 2 (EPS8L2) ELISA Kit

  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein


EPS8 Rabbit Polyclonal Antibody