eEF2 antibody

eEF2 antibody


eEF2 antibody

70R-31022 100 ug
EUR 327
Description: Rabbit polyclonal eEF2 antibody

EEF2 Antibody

32582-100ul 100ul
EUR 252

EEF2 antibody

10R-10728 100 ug
EUR 381
Description: Mouse monoclonal EEF2 antibody

EEF2 antibody

10R-11163 100 ug
EUR 349
Description: Mouse Monoclonal EEF2 antibody

EEF2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

EEF2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100

EEF2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100

EEF2 Antibody

DF6798 200ul
EUR 304
Description: EEF2 Antibody detects endogenous levels of total EEF2.

EEF2 antibody

70R-51523 100 ul
EUR 244
Description: Purified Polyclonal EEF2 antibody

EEF2 Antibody

BF0405 200ul
EUR 376
Description: EEF2 antibody detects endogenous levels of total EEF2.

EEF2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

EEF2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

eEF2 Antibody

AF7720 200ul
EUR 376
Description: eEF2 Antibody detects endogenous levels of eEF2.

eEF2 Antibody

AF7721 200ul
EUR 376
Description: eEF2 Antibody detects endogenous levels of eEF2.

EEF2 Antibody

ABD6798 100 ug
EUR 438

EEF2 Monoclonal Antibody

27102-100ul 100ul
EUR 252

EEF2 Monoclonal Antibody

27102-50ul 50ul
EUR 187

eEF2 antibody (Thr56)

70R-31021 100 ug
EUR 327
Description: Rabbit polyclonal eEF2 antibody (Thr56)

eEF2 Polyclonal Antibody

ABP58457-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein

eEF2 Polyclonal Antibody

ABP58457-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein

eEF2 Polyclonal Antibody

ABP58457-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein

EEF2 (pT56) Antibody

  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

EEF2 Conjugated Antibody

C32582 100ul
EUR 397

EEF2 Polyclonal Antibody

A53432 100 µg
EUR 570.55
Description: reagents widely cited

anti- EEF2 antibody

FNab02651 100µg
EUR 585
  • Immunogen: eukaryotic translation elongation factor 2
  • Uniprot ID: P13639
  • Gene ID: 1938
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against EEF2

Anti-EEF2 antibody

PAab02651 100 ug
EUR 412

Anti-EEF2 antibody

STJ114864 100 µl
EUR 277
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation.

Anti-EEF2 antibody

STJ23480 100 µl
EUR 277
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation.

Anti-eEF2 antibody

STJ99117 200 µl
EUR 197
Description: Mouse monoclonal to eEF2.

Anti-eEF2 antibody

STJ99607 200 µl
EUR 197
Description: Rabbit polyclonal to eEF2.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

eEF2 (Phospho-Tyr443) Antibody

13078-100ul 100ul
EUR 252

eEF2 (Phospho-Tyr443) Antibody

13078-50ul 50ul
EUR 187

eEF2 (Phospho-Thr57) Antibody

13079-100ul 100ul
EUR 252

eEF2 (Phospho-Thr57) Antibody

13079-50ul 50ul
EUR 187

Phospho-eEF2 (Tyr443) Antibody

AF7220 200ul
EUR 376
Description: Phospho-eEF2 (Tyr443) Antibody detects endogenous levels of eEF2 only when phosphorylated at Tyr443.

Phospho-eEF2 (Thr57) Antibody

AF7221 200ul
EUR 376
Description: Phospho-eEF2 (Thr57) Antibody detects endogenous levels of eEF2 only when phosphorylated at Thr57.

EEF2 Conjugated Monoclonal Antibody

C27102 100ul
EUR 397

EEF2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EEF2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EEF2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-EEF2 (T56) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-EEF2 (T56). Recognizes Phospho-EEF2 (T56) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

Phospho- eEF2 (Thr56) Antibody

ABF3572 100 ug
EUR 438

EEF2 recombinant monoclonal antibody

A5481 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human EEF2 for WB, IHC, IF,ELISA

Anti-EEF2 Monoclonal Antibody

M00830-1 100ug
EUR 397
Description: Rabbit Monoclonal EEF2 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

EEF2 Blocking Peptide

33R-9020 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF2 antibody, catalog no. 70R-2318

EEF2 Blocking Peptide

DF6798-BP 1mg
EUR 195

EEF2 Rabbit pAb

A0099-100ul 100 ul
EUR 308

EEF2 Rabbit pAb

A0099-200ul 200 ul
EUR 459

EEF2 Rabbit pAb

A0099-20ul 20 ul
EUR 183

EEF2 Rabbit pAb

A0099-50ul 50 ul
EUR 223

EEF2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

EEF2 Blocking Peptide

BF0405-BP 1mg
EUR 195

eEF2 Blocking Peptide

AF7720-BP 1mg
EUR 195

eEF2 Blocking Peptide

AF7721-BP 1mg
EUR 195

EEF2 cloning plasmid

CSB-CL007434HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2577
  • Sequence: atggtgaacttcacggtagaccagatccgcgccatcatggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaagtccacgctgacagactccctggtgtgcaaggcgggcatcatcgcctcggcccgggccggggagacacgcttcactgata
  • Show more
Description: A cloning plasmid for the EEF2 gene.

EEF2 Rabbit pAb

A2068-100ul 100 ul
EUR 308

EEF2 Rabbit pAb

A2068-200ul 200 ul
EUR 459

EEF2 Rabbit pAb

A2068-20ul 20 ul
EUR 183

EEF2 Rabbit pAb

A2068-50ul 50 ul
EUR 223

eEF2, Rabbit Reticulocytes

EUR 370

anti-EEF2 (5B6)

LF-MA30553 100 ul
EUR 527
Description: Mouse Monoclonal to EEF2

eEF2 (Phospho-Thr56) Polyclonal Antibody

ABP58456-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein

eEF2 (Phospho-Thr56) Polyclonal Antibody

ABP58456-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein

eEF2 (Phospho-Thr56) Polyclonal Antibody

ABP58456-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein

eEF2 (Phospho-Tyr443) Conjugated Antibody

C13078 100ul
EUR 397

eEF2 (Phospho-Thr57) Conjugated Antibody

C13079 100ul
EUR 397

Monoclonal EEF2 Antibody, Clone: 5B6

APR07656G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human EEF2. The antibodies are raised in Mouse and are from clone 5B6. This antibody is applicable in WB and IHC, ICC, E

EEF2 Polyclonal Antibody, Biotin Conjugated

A53429 100 µg
EUR 570.55
Description: fast delivery possible

EEF2 Polyclonal Antibody, FITC Conjugated

A53430 100 µg
EUR 570.55
Description: reagents widely cited

EEF2 Polyclonal Antibody, HRP Conjugated

A53431 100 µg
EUR 570.55
Description: Ask the seller for details

Anti-Phospho-EEF2-T56 antibody

STJ11100973 100 µl
EUR 393
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation.

Anti-Phospho-eEF2 (Thr56) antibody

STJ99592 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-eEF2 (Thr56).

Anti-EEF2 Antibody (4B3-G7-H5)

EUR 338

EEF2 protein (His tag)

80R-3897 100 ug
EUR 327
Description: Purified recombinant EEF2 protein (His tag)

EEF2 (pT56) Blocking Peptide

  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.


EF004938 96 Tests
EUR 689

Rat EEF2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EEF2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EEF2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-HA-EEF2 Plasmid

PVTB00283-2a 2 ug
EUR 356

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

abx159481-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

abx012012-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 495.00
  • EUR 578.00
  • EUR 286.00
  • EUR 885.00
  • EUR 370.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

abx232651-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Elongation factor 2 (EEF2)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 99.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 2(EEF2) expressed in E.coli

Mouse Elongation factor 2 (Eef2)

  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 97.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Elongation factor 2(Eef2) expressed in Yeast

Phospho-EEF2-T56 Rabbit pAb

AP0832-100ul 100 ul
EUR 384

Phospho-EEF2-T56 Rabbit pAb

AP0832-200ul 200 ul
EUR 554

Phospho-EEF2-T56 Rabbit pAb

AP0832-20ul 20 ul
EUR 183

Phospho-EEF2-T56 Rabbit pAb

AP0832-50ul 50 ul
EUR 265


eEF2 antibody