DYRK3 Rabbit Polyclonal Antibody
DYRK3 Polyclonal Antibody |
ES9026-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DYRK3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DYRK3 Polyclonal Antibody |
ES9026-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DYRK3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Dyrk3 antibody |
22581-100ul |
SAB |
100ul |
EUR 390 |
Dyrk3 antibody |
70R-13121 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal Dyrk3 antibody |
DYRK3 Antibody |
DF8760 |
Affbiotech |
200ul |
EUR 304 |
Description: DYRK3 Antibody detects endogenous levels of total DYRK3. |
DYRK3 Antibody |
1-CSB-PA007312LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:50-1:200 |
Polyclonal DYRK3 Antibody (N-term) |
APR05926G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK3 (N-term). This antibody is tested and proven to work in the following applications: |
DYRK3 Polyclonal Antibody, HRP Conjugated |
A62451 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
DYRK3 Polyclonal Antibody, FITC Conjugated |
A62452 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
DYRK3 Polyclonal Antibody, Biotin Conjugated |
A62453 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Polyclonal DYRK3 antibody - N-terminal region |
APR00549G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK3 - N-terminal region. This antibody is tested and proven to work in the following applications: |
DYRK3 Antibody (HRP) |
20-abx303689 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DYRK3 Antibody (FITC) |
20-abx303690 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DYRK3 Antibody (Biotin) |
20-abx303691 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-DYRK3 antibody |
STJ190184 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DYRK3 |
DYRK3 siRNA |
20-abx901619 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DYRK3 siRNA |
20-abx914831 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DYRK3 siRNA |
20-abx914832 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DYRK3 Antibody, HRP conjugated |
1-CSB-PA007312LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
DYRK3 Antibody, FITC conjugated |
1-CSB-PA007312LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
DYRK3 Antibody, Biotin conjugated |
1-CSB-PA007312LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
DYRK3 Blocking Peptide |
DF8760-BP |
Affbiotech |
1mg |
EUR 195 |
DYRK3 cloning plasmid |
CSB-CL007312HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1707
- Sequence: atgaagtggaaagagaagttgggggatggtgtctatgacaccttcatgatgatagatgaaaccaaatgtcccccctgttcaaatgtactctgcaatccttctgaaccacctccacccagaagactaaatatgaccactgagcagtttacaggagatcatactcagcactttttgg
- Show more
|
Description: A cloning plasmid for the DYRK3 gene. |
Anti-DYRK3 (3E10) |
YF-MA11063 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DYRK3 |
Rat DYRK3 shRNA Plasmid |
20-abx989287 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DYRK3 shRNA Plasmid |
20-abx955532 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse DYRK3 shRNA Plasmid |
20-abx981488 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Dyrk3 ORF Vector (Rat) (pORF) |
ORF066307 |
ABM |
1.0 ug DNA |
EUR 506 |
DYRK3 ORF Vector (Human) (pORF) |
ORF003352 |
ABM |
1.0 ug DNA |
EUR 95 |
Dyrk3 ORF Vector (Mouse) (pORF) |
ORF043493 |
ABM |
1.0 ug DNA |
EUR 506 |
DYRK3 sgRNA CRISPR Lentivector set (Human) |
K0645301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dyrk3 sgRNA CRISPR Lentivector set (Rat) |
K6244801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dyrk3 sgRNA CRISPR Lentivector set (Mouse) |
K4482401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody |
abx033458-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody |
abx033458-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody |
20-abx303688 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DYRK3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0645302 |
ABM |
1.0 ug DNA |
EUR 154 |
DYRK3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0645303 |
ABM |
1.0 ug DNA |
EUR 154 |
DYRK3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0645304 |
ABM |
1.0 ug DNA |
EUR 154 |
Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6244802 |
ABM |
1.0 ug DNA |
EUR 154 |
Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6244803 |
ABM |
1.0 ug DNA |
EUR 154 |
Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6244804 |
ABM |
1.0 ug DNA |
EUR 154 |
Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4482402 |
ABM |
1.0 ug DNA |
EUR 154 |
Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4482403 |
ABM |
1.0 ug DNA |
EUR 154 |
Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4482404 |
ABM |
1.0 ug DNA |
EUR 154 |
DYRK3 Protein Vector (Mouse) (pPB-C-His) |
PV173970 |
ABM |
500 ng |
EUR 603 |
DYRK3 Protein Vector (Mouse) (pPB-N-His) |
PV173971 |
ABM |
500 ng |
EUR 603 |
DYRK3 Protein Vector (Mouse) (pPM-C-HA) |
PV173972 |
ABM |
500 ng |
EUR 603 |
DYRK3 Protein Vector (Mouse) (pPM-C-His) |
PV173973 |
ABM |
500 ng |
EUR 603 |
DYRK3 Protein Vector (Rat) (pPB-C-His) |
PV265226 |
ABM |
500 ng |
EUR 603 |
DYRK3 Protein Vector (Rat) (pPB-N-His) |
PV265227 |
ABM |
500 ng |
EUR 603 |
DYRK3 Protein Vector (Rat) (pPM-C-HA) |
PV265228 |
ABM |
500 ng |
EUR 603 |
DYRK3 Protein Vector (Rat) (pPM-C-His) |
PV265229 |
ABM |
500 ng |
EUR 603 |
DYRK3 Protein Vector (Human) (pPB-C-His) |
PV013405 |
ABM |
500 ng |
EUR 329 |
DYRK3 Protein Vector (Human) (pPB-N-His) |
PV013406 |
ABM |
500 ng |
EUR 329 |
DYRK3 Protein Vector (Human) (pPM-C-HA) |
PV013407 |
ABM |
500 ng |
EUR 329 |
DYRK3 Protein Vector (Human) (pPM-C-His) |
PV013408 |
ABM |
500 ng |
EUR 329 |
Dyrk3 3'UTR GFP Stable Cell Line |
TU155499 |
ABM |
1.0 ml |
Ask for price |
Dyrk3 3'UTR Luciferase Stable Cell Line |
TU105499 |
ABM |
1.0 ml |
Ask for price |
Dyrk3 3'UTR Luciferase Stable Cell Line |
TU203726 |
ABM |
1.0 ml |
Ask for price |
Dyrk3 3'UTR GFP Stable Cell Line |
TU253726 |
ABM |
1.0 ml |
Ask for price |
DYRK3 3'UTR GFP Stable Cell Line |
TU056474 |
ABM |
1.0 ml |
EUR 1394 |
DYRK3 3'UTR Luciferase Stable Cell Line |
TU006474 |
ABM |
1.0 ml |
EUR 1394 |
DYRK3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV667165 |
ABM |
1.0 ug DNA |
EUR 682 |
DYRK3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV667169 |
ABM |
1.0 ug DNA |
EUR 682 |
DYRK3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV667170 |
ABM |
1.0 ug DNA |
EUR 682 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
DYRK3 Rabbit Polyclonal Antibody