DYRK3 Rabbit Polyclonal Antibody

DYRK3 Rabbit Polyclonal Antibody


DYRK3 Polyclonal Antibody

ES9026-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DYRK3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

DYRK3 Polyclonal Antibody

ES9026-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DYRK3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Dyrk3 antibody

22581-100ul 100ul
EUR 390

Dyrk3 antibody

70R-13121 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal Dyrk3 antibody

DYRK3 Antibody

DF8760 200ul
EUR 304
Description: DYRK3 Antibody detects endogenous levels of total DYRK3.

DYRK3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:50-1:200

DYRK3 Antibody

ABD8760 100 ug
EUR 438

Polyclonal DYRK3 Antibody (N-term)

APR05926G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK3 (N-term). This antibody is tested and proven to work in the following applications:

DYRK3 Polyclonal Antibody, HRP Conjugated

A62451 100 µg
EUR 570.55
Description: The best epigenetics products

DYRK3 Polyclonal Antibody, FITC Conjugated

A62452 100 µg
EUR 570.55
Description: kits suitable for this type of research

DYRK3 Polyclonal Antibody, Biotin Conjugated

A62453 100 µg
EUR 570.55
Description: fast delivery possible

Dyrk3/ Rat Dyrk3 ELISA Kit

ELI-32432r 96 Tests
EUR 886

Polyclonal DYRK3 antibody - N-terminal region

APR00549G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK3 - N-terminal region. This antibody is tested and proven to work in the following applications:

DYRK3 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DYRK3 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DYRK3 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-DYRK3 antibody

STJ190184 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DYRK3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYRK3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DYRK3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DYRK3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DYRK3 Blocking Peptide

DF8760-BP 1mg
EUR 195

DYRK3 cloning plasmid

CSB-CL007312HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1707
  • Sequence: atgaagtggaaagagaagttgggggatggtgtctatgacaccttcatgatgatagatgaaaccaaatgtcccccctgttcaaatgtactctgcaatccttctgaaccacctccacccagaagactaaatatgaccactgagcagtttacaggagatcatactcagcactttttgg
  • Show more
Description: A cloning plasmid for the DYRK3 gene.

Anti-DYRK3 (3E10)

YF-MA11063 100 ug
EUR 363
Description: Mouse monoclonal to DYRK3

Mouse Dyrk3 ELISA KIT

ELI-09352m 96 Tests
EUR 865


ELI-31567h 96 Tests
EUR 824

Rat DYRK3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DYRK3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DYRK3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Dyrk3 ORF Vector (Rat) (pORF)

ORF066307 1.0 ug DNA
EUR 506

DYRK3 ORF Vector (Human) (pORF)

ORF003352 1.0 ug DNA
EUR 95

Dyrk3 ORF Vector (Mouse) (pORF)

ORF043493 1.0 ug DNA
EUR 506

DYRK3 sgRNA CRISPR Lentivector set (Human)

K0645301 3 x 1.0 ug
EUR 339

Dyrk3 sgRNA CRISPR Lentivector set (Rat)

K6244801 3 x 1.0 ug
EUR 339

Dyrk3 sgRNA CRISPR Lentivector set (Mouse)

K4482401 3 x 1.0 ug
EUR 339

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody

abx033458-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody

abx033458-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DYRK3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0645302 1.0 ug DNA
EUR 154

DYRK3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0645303 1.0 ug DNA
EUR 154

DYRK3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0645304 1.0 ug DNA
EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6244802 1.0 ug DNA
EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6244803 1.0 ug DNA
EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6244804 1.0 ug DNA
EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4482402 1.0 ug DNA
EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4482403 1.0 ug DNA
EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4482404 1.0 ug DNA
EUR 154

DYRK3 Protein Vector (Mouse) (pPB-C-His)

PV173970 500 ng
EUR 603

DYRK3 Protein Vector (Mouse) (pPB-N-His)

PV173971 500 ng
EUR 603

DYRK3 Protein Vector (Mouse) (pPM-C-HA)

PV173972 500 ng
EUR 603

DYRK3 Protein Vector (Mouse) (pPM-C-His)

PV173973 500 ng
EUR 603

DYRK3 Protein Vector (Rat) (pPB-C-His)

PV265226 500 ng
EUR 603

DYRK3 Protein Vector (Rat) (pPB-N-His)

PV265227 500 ng
EUR 603

DYRK3 Protein Vector (Rat) (pPM-C-HA)

PV265228 500 ng
EUR 603

DYRK3 Protein Vector (Rat) (pPM-C-His)

PV265229 500 ng
EUR 603

DYRK3 Protein Vector (Human) (pPB-C-His)

PV013405 500 ng
EUR 329

DYRK3 Protein Vector (Human) (pPB-N-His)

PV013406 500 ng
EUR 329

DYRK3 Protein Vector (Human) (pPM-C-HA)

PV013407 500 ng
EUR 329

DYRK3 Protein Vector (Human) (pPM-C-His)

PV013408 500 ng
EUR 329

Dyrk3 3'UTR GFP Stable Cell Line

TU155499 1.0 ml Ask for price

Dyrk3 3'UTR Luciferase Stable Cell Line

TU105499 1.0 ml Ask for price

Dyrk3 3'UTR Luciferase Stable Cell Line

TU203726 1.0 ml Ask for price

Dyrk3 3'UTR GFP Stable Cell Line

TU253726 1.0 ml Ask for price

DYRK3 3'UTR GFP Stable Cell Line

TU056474 1.0 ml
EUR 1394

DYRK3 3'UTR Luciferase Stable Cell Line

TU006474 1.0 ml
EUR 1394

DYRK3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV667165 1.0 ug DNA
EUR 682

DYRK3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV667169 1.0 ug DNA
EUR 682

DYRK3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV667170 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1


DYRK3 Rabbit Polyclonal Antibody