DYRK3 Rabbit Polyclonal Antibody
 DYRK3 Polyclonal Antibody |
|
ES9026-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against DYRK3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DYRK3 Polyclonal Antibody |
|
ES9026-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against DYRK3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 Dyrk3 antibody |
|
22581-100ul |
SAB |
100ul |
EUR 390 |
Dyrk3 antibody |
|
70R-13121 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal Dyrk3 antibody |
 DYRK3 Antibody |
|
DF8760 |
Affbiotech |
200ul |
EUR 304 |
|
Description: DYRK3 Antibody detects endogenous levels of total DYRK3. |
DYRK3 Antibody |
|
1-CSB-PA007312LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:50-1:200 |
) Polyclonal DYRK3 Antibody (N-term) |
|
APR05926G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK3 (N-term). This antibody is tested and proven to work in the following applications: |
 DYRK3 Polyclonal Antibody, HRP Conjugated |
|
A62451 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 DYRK3 Polyclonal Antibody, FITC Conjugated |
|
A62452 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 DYRK3 Polyclonal Antibody, Biotin Conjugated |
|
A62453 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 Polyclonal DYRK3 antibody - N-terminal region |
|
APR00549G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK3 - N-terminal region. This antibody is tested and proven to work in the following applications: |
) DYRK3 Antibody (HRP) |
|
20-abx303689 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) DYRK3 Antibody (FITC) |
|
20-abx303690 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) DYRK3 Antibody (Biotin) |
|
20-abx303691 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Anti-DYRK3 antibody |
|
STJ190184 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to DYRK3 |
 DYRK3 siRNA |
|
20-abx901619 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DYRK3 siRNA |
|
20-abx914831 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DYRK3 siRNA |
|
20-abx914832 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 DYRK3 Antibody, HRP conjugated |
|
1-CSB-PA007312LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 DYRK3 Antibody, FITC conjugated |
|
1-CSB-PA007312LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 DYRK3 Antibody, Biotin conjugated |
|
1-CSB-PA007312LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 DYRK3 Blocking Peptide |
|
DF8760-BP |
Affbiotech |
1mg |
EUR 195 |
 DYRK3 cloning plasmid |
|
CSB-CL007312HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1707
- Sequence: atgaagtggaaagagaagttgggggatggtgtctatgacaccttcatgatgatagatgaaaccaaatgtcccccctgttcaaatgtactctgcaatccttctgaaccacctccacccagaagactaaatatgaccactgagcagtttacaggagatcatactcagcactttttgg
- Show more
|
|
Description: A cloning plasmid for the DYRK3 gene. |
) Anti-DYRK3 (3E10) |
|
YF-MA11063 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to DYRK3 |
 Rat DYRK3 shRNA Plasmid |
|
20-abx989287 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human DYRK3 shRNA Plasmid |
|
20-abx955532 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse DYRK3 shRNA Plasmid |
|
20-abx981488 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 (pORF)) Dyrk3 ORF Vector (Rat) (pORF) |
|
ORF066307 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) DYRK3 ORF Vector (Human) (pORF) |
|
ORF003352 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Dyrk3 ORF Vector (Mouse) (pORF) |
|
ORF043493 |
ABM |
1.0 ug DNA |
EUR 506 |
) DYRK3 sgRNA CRISPR Lentivector set (Human) |
|
K0645301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Dyrk3 sgRNA CRISPR Lentivector set (Rat) |
|
K6244801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Dyrk3 sgRNA CRISPR Lentivector set (Mouse) |
|
K4482401 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody) Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody |
|
abx033458-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody |
|
abx033458-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody |
|
20-abx303688 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (Target 1)) DYRK3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0645302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) DYRK3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0645303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) DYRK3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0645304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6244802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6244803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6244804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4482402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4482403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4482404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) DYRK3 Protein Vector (Mouse) (pPB-C-His) |
|
PV173970 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) DYRK3 Protein Vector (Mouse) (pPB-N-His) |
|
PV173971 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) DYRK3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV173972 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) DYRK3 Protein Vector (Mouse) (pPM-C-His) |
|
PV173973 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) DYRK3 Protein Vector (Rat) (pPB-C-His) |
|
PV265226 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) DYRK3 Protein Vector (Rat) (pPB-N-His) |
|
PV265227 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) DYRK3 Protein Vector (Rat) (pPM-C-HA) |
|
PV265228 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) DYRK3 Protein Vector (Rat) (pPM-C-His) |
|
PV265229 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) DYRK3 Protein Vector (Human) (pPB-C-His) |
|
PV013405 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) DYRK3 Protein Vector (Human) (pPB-N-His) |
|
PV013406 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) DYRK3 Protein Vector (Human) (pPM-C-HA) |
|
PV013407 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) DYRK3 Protein Vector (Human) (pPM-C-His) |
|
PV013408 |
ABM |
500 ng |
EUR 329 |
 Dyrk3 3'UTR GFP Stable Cell Line |
|
TU155499 |
ABM |
1.0 ml |
Ask for price |
 Dyrk3 3'UTR Luciferase Stable Cell Line |
|
TU105499 |
ABM |
1.0 ml |
Ask for price |
Dyrk3 3'UTR Luciferase Stable Cell Line |
|
TU203726 |
ABM |
1.0 ml |
Ask for price |
Dyrk3 3'UTR GFP Stable Cell Line |
|
TU253726 |
ABM |
1.0 ml |
Ask for price |
 DYRK3 3'UTR GFP Stable Cell Line |
|
TU056474 |
ABM |
1.0 ml |
EUR 1394 |
 DYRK3 3'UTR Luciferase Stable Cell Line |
|
TU006474 |
ABM |
1.0 ml |
EUR 1394 |
 (CMV) (pLenti-GIII-CMV)) DYRK3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV667165 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) DYRK3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV667169 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) DYRK3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV667170 |
ABM |
1.0 ug DNA |
EUR 682 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
DYRK3 Rabbit Polyclonal Antibody
