DYRK2 Rabbit Polyclonal Antibody
DYRK2 Polyclonal Antibody |
ABP58441-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein |
DYRK2 Polyclonal Antibody |
ABP58441-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein |
DYRK2 Polyclonal Antibody |
ABP58441-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein |
Polyclonal DYRK2 Antibody |
AMM06984G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 . This antibody is tested and proven to work in the following applications: |
DYRK2 Polyclonal Antibody |
ES8952-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DYRK2 Polyclonal Antibody |
ES8952-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DYRK2 Polyclonal Antibody |
ES10813-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DYRK2 Polyclonal Antibody |
ES10813-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DYRK2 Rabbit pAb |
A7012-100ul |
Abclonal |
100 ul |
EUR 308 |
DYRK2 Rabbit pAb |
A7012-200ul |
Abclonal |
200 ul |
EUR 459 |
DYRK2 Rabbit pAb |
A7012-20ul |
Abclonal |
20 ul |
EUR 183 |
DYRK2 Rabbit pAb |
A7012-50ul |
Abclonal |
50 ul |
EUR 223 |
DYRK2 Polyclonal Conjugated Antibody |
C42670 |
SAB |
100ul |
EUR 397 |
DYRK2 Antibody |
25289-100ul |
SAB |
100ul |
EUR 390 |
DYRK2 Antibody |
1-CSB-PA852896ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against DYRK2. Recognizes DYRK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
DYRK2 Antibody |
DF10136 |
Affbiotech |
200ul |
EUR 304 |
Description: DYRK2 Antibody detects endogenous levels of total DYRK2. |
Polyclonal DYRK2 Antibody (C-Terminus) |
AMM06986G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal DYRK2 Antibody (N-term) |
APR14269G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal Mouse Dyrk2 Antibody (C-term) |
APR17418G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Dyrk2 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal DYRK2 antibody - C-terminal region |
AMM06987G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
DYRK2/4 Antibody |
DF10330 |
Affbiotech |
200ul |
EUR 304 |
Description: DYRK2/4 Antibody detects endogenous levels of DYRK2/4. |
Anti-DYRK2 antibody |
STJ29092 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert. |
Anti-DYRK2 antibody |
STJ190110 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DYRK2 |
Anti-DYRK2 antibody |
STJ191971 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DYRK2 |
DYRK2 siRNA |
20-abx914829 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DYRK2 siRNA |
20-abx914830 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DYRK2/4 (Phospho-Tyr386/268) Polyclonal Conjugated Antibody |
C12498 |
SAB |
100ul |
EUR 397 |
DYRK2 Blocking Peptide |
DF10136-BP |
Affbiotech |
1mg |
EUR 195 |
DYRK2 cloning plasmid |
CSB-CL852896HU1-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1587
- Sequence: atgaatgatcacctgcatgtcggcagccacgctcacggacagatccaggttcaacagttgtttgaggataacagtaacaagcggacagtgctcacgacacaaccaaatgggcttacaacagtgggcaaaacgggcttgccagtggtgccagagcggcagctggacagcattcata
- Show more
|
Description: A cloning plasmid for the DYRK2 gene. |
DYRK2 cloning plasmid |
CSB-CL852896HU2-10ug |
Cusabio |
10ug |
EUR 615 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1806
- Sequence: atgttaaccaggaaaccttcggccgccgctcccgccgcctacccgaccggccgaggtggggacagcgccgttcgtcagcttcaggcttccccggggctcggtgcaggggccacccggagcggagtggggactggcccgccctcccccatcgccctgccgcctctccgggccagca
- Show more
|
Description: A cloning plasmid for the DYRK2 gene. |
DYRK2 Rabbit Polyclonal Antibody