DYRK2 Rabbit Polyclonal Antibody

DYRK2 Rabbit Polyclonal Antibody

 

DYRK2 Polyclonal Antibody

ABP58441-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein

DYRK2 Polyclonal Antibody

ABP58441-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein

DYRK2 Polyclonal Antibody

ABP58441-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein

Polyclonal DYRK2 Antibody

AMM06984G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 . This antibody is tested and proven to work in the following applications:

DYRK2 Polyclonal Antibody

ES8952-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DYRK2 Polyclonal Antibody

ES8952-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DYRK2 Polyclonal Antibody

ES10813-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DYRK2 Polyclonal Antibody

ES10813-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DYRK2 Rabbit pAb

A7012-100ul 100 ul
EUR 308

DYRK2 Rabbit pAb

A7012-200ul 200 ul
EUR 459

DYRK2 Rabbit pAb

A7012-20ul 20 ul
EUR 183

DYRK2 Rabbit pAb

A7012-50ul 50 ul
EUR 223

DYRK2 Polyclonal Conjugated Antibody

C42670 100ul
EUR 397

DYRK2 Antibody

25289-100ul 100ul
EUR 390

DYRK2 Antibody

1-CSB-PA852896ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DYRK2. Recognizes DYRK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DYRK2 Antibody

DF10136 200ul
EUR 304
Description: DYRK2 Antibody detects endogenous levels of total DYRK2.

DYRK2 Antibody

ABD10136 100 ug
EUR 438

Polyclonal DYRK2 Antibody (C-Terminus)

AMM06986G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal DYRK2 Antibody (N-term)

APR14269G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Mouse Dyrk2 Antibody (C-term)

APR17418G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Dyrk2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal DYRK2 antibody - C-terminal region

AMM06987G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 - C-terminal region. This antibody is tested and proven to work in the following applications:

DYRK2/4 Antibody

DF10330 200ul
EUR 304
Description: DYRK2/4 Antibody detects endogenous levels of DYRK2/4.

Anti-DYRK2 antibody

STJ29092 100 µl
EUR 277
Description: DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert.

Anti-DYRK2 Antibody

STJ500807 100 µg
EUR 476

Anti-DYRK2 antibody

STJ190110 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DYRK2

Anti-DYRK2 antibody

STJ191971 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DYRK2

DYRK2 siRNA

20-abx914829
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYRK2 siRNA

20-abx914830
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-DYRK2 Antibody (Biotin)

STJ500808 100 µg
EUR 586

Anti-DYRK2 Antibody (FITC)

STJ500809 100 µg
EUR 586

DYRK2/4 (Phospho-Tyr386/268) Polyclonal Conjugated Antibody

C12498 100ul
EUR 397

DYRK2 Blocking Peptide

DF10136-BP 1mg
EUR 195

DYRK2 cloning plasmid

CSB-CL852896HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1587
  • Sequence: atgaatgatcacctgcatgtcggcagccacgctcacggacagatccaggttcaacagttgtttgaggataacagtaacaagcggacagtgctcacgacacaaccaaatgggcttacaacagtgggcaaaacgggcttgccagtggtgccagagcggcagctggacagcattcata
  • Show more
Description: A cloning plasmid for the DYRK2 gene.

DYRK2 cloning plasmid

CSB-CL852896HU2-10ug 10ug
EUR 615
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1806
  • Sequence: atgttaaccaggaaaccttcggccgccgctcccgccgcctacccgaccggccgaggtggggacagcgccgttcgtcagcttcaggcttccccggggctcggtgcaggggccacccggagcggagtggggactggcccgccctcccccatcgccctgccgcctctccgggccagca
  • Show more
Description: A cloning plasmid for the DYRK2 gene.

 

DYRK2 Rabbit Polyclonal Antibody