DMP1 Rabbit Polyclonal Antibody

DMP1 Rabbit Polyclonal Antibody


DMP1 Polyclonal Antibody

ABP58392-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DMP1 protein at amino acid sequence of 430-510
  • Applications tips:
Description: A polyclonal antibody for detection of DMP1 from Human. This DMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DMP1 protein at amino acid sequence of 430-510

DMP1 Rabbit pAb

A11076-100ul 100 ul
EUR 308

DMP1 Rabbit pAb

A11076-200ul 200 ul
EUR 459

DMP1 Rabbit pAb

A11076-20ul 20 ul
EUR 183

DMP1 Rabbit pAb

A11076-50ul 50 ul
EUR 223

DMP1 Rabbit pAb

A16832-100ul 100 ul
EUR 308

DMP1 Rabbit pAb

A16832-200ul 200 ul
EUR 459

DMP1 Rabbit pAb

A16832-20ul 20 ul
EUR 183

DMP1 Rabbit pAb

A16832-50ul 50 ul
EUR 223

DMP1 Antibody

ABD8825 100 ug
EUR 438

DMP1 Antibody

EUR 354

DMP1 Antibody

EUR 146

DMP1 antibody

38779-100ul 100ul
EUR 252

DMP1 antibody

70R-12137 100 ug
EUR 460
Description: Rabbit polyclonal DMP1 antibody

DMP1 Antibody

DF8825 200ul
EUR 304
Description: DMP1 Antibody detects endogenous levels of total DMP1.

DMP1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DMP1. Recognizes DMP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal DMP1 Antibody (N-term)

APR15749G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DMP1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-DMP1 Antibody

APR16266G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-DMP1 . This antibody is tested and proven to work in the following applications:

DMP1 Conjugated Antibody

C38779 100ul
EUR 397

Anti-DMP1 antibody

STJ71708 100 µg
EUR 359

Anti-DMP1 antibody

STJ113700 100 µl
EUR 277
Description: Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene.

Anti-DMP1 antibody

STJ119209 100 µl
EUR 277

Anti-DMP1 antibody

STJ190216 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DMP1

Dmp1/ Rat Dmp1 ELISA Kit

ELI-06670r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DMP1 cloning plasmid

CSB-CL006967HU-10ug 10ug
EUR 541
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1542
  • Sequence: atgaagatcagcatcctgctcatgttcctttggggattatcctgtgctctcccagtaaccaggtatcaaaataatgaatctgaggattctgaagaatggaagggtcatttggctcaggcaccaacaccacccttggagagcagtgagtcatcagaaggcagtaaagttagctcag
  • Show more
Description: A cloning plasmid for the DMP1 gene.

DMP1 Blocking Peptide

33R-10953 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DMP1 antibody, catalog no. 70R-12137

DMP1 Blocking Peptide

EUR 153

DMP1 Blocking Peptide

DF8825-BP 1mg
EUR 195

Anti-DMP1 (1D4)

YF-MA12712 100 ug
EUR 363
Description: Mouse monoclonal to DMP1

Human DMP1 ELISA Kit

ELA-E2078h 96 Tests
EUR 824


EF006172 96 Tests
EUR 689

Human DMP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DMP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Dog Uncharacterized protein (DMP1)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 63.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Dog Uncharacterized protein(DMP1) expressed in E.coli

DMP1 Recombinant Protein (Human)

RP038551 100 ug Ask for price

DMP1 Recombinant Protein (Rat)

RP198224 100 ug Ask for price

DMP1 Recombinant Protein (Mouse)

RP129329 100 ug Ask for price

Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody

abx030674-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody

abx030674-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody

abx432613-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Dmp1 ORF Vector (Rat) (pORF)

ORF066076 1.0 ug DNA
EUR 506

Dmp1 ORF Vector (Mouse) (pORF)

ORF043111 1.0 ug DNA
EUR 506

DMP1 ORF Vector (Human) (pORF)

ORF012851 1.0 ug DNA
EUR 354

DMP1 ELISA Kit (Rat) (OKCA02543)

OKCA02543 96 Wells
EUR 846
Description: Description of target: May have a dual function during osteoblast differentiation. In the nucleus of undifferentiated osteoblasts, unphosphorylated form acts as a transcriptional component for activation of osteoblast-specific genes like osteocalcin. During the osteoblast to osteocyte transition phase it is phosphorylated and exported into the extracellular matrix, where it regulates nucleation of hydroxyapatite.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.156 ng/mL

DMP1 ELISA Kit (Rat) (OKEH06061)

OKEH06061 96 Wells
EUR 662
Description: Description of target: May have a dual function during osteoblast differentiation. In the nucleus of undifferentiated osteoblasts, unphosphorylated form acts as a transcriptional component for activation of osteoblast-specific genes like osteocalcin. During the osteoblast to osteocyte transition phase it is phosphorylated and exported into the extracellular matrix, where it regulates nucleation of hydroxyapatite.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 41 pg/mL

DMP1 sgRNA CRISPR Lentivector set (Human)

K0609601 3 x 1.0 ug
EUR 339

Dmp1 sgRNA CRISPR Lentivector set (Mouse)

K3915301 3 x 1.0 ug
EUR 339

Dmp1 sgRNA CRISPR Lentivector set (Rat)

K6816901 3 x 1.0 ug
EUR 339

DMP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0609602 1.0 ug DNA
EUR 154

DMP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0609603 1.0 ug DNA
EUR 154

DMP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0609604 1.0 ug DNA
EUR 154

Human Dentin matrix acidic phosphoprotein 1 (DMP1)

  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 56 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dentin matrix acidic phosphoprotein 1(DMP1) expressed in Yeast

Dmp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3915302 1.0 ug DNA
EUR 154

Dmp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3915303 1.0 ug DNA
EUR 154

Dmp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3915304 1.0 ug DNA
EUR 154

Dmp1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6816902 1.0 ug DNA
EUR 154

Dmp1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6816903 1.0 ug DNA
EUR 154

Dmp1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6816904 1.0 ug DNA
EUR 154

DMP1 Protein Vector (Human) (pPB-C-His)

PV051401 500 ng
EUR 481

DMP1 Protein Vector (Human) (pPB-N-His)

PV051402 500 ng
EUR 481

DMP1 Protein Vector (Human) (pPM-C-HA)

PV051403 500 ng
EUR 481

DMP1 Protein Vector (Human) (pPM-C-His)

PV051404 500 ng
EUR 481

DMP1 Protein Vector (Mouse) (pPB-C-His)

PV172442 500 ng
EUR 603

DMP1 Protein Vector (Mouse) (pPB-N-His)

PV172443 500 ng
EUR 603

DMP1 Protein Vector (Mouse) (pPM-C-HA)

PV172444 500 ng
EUR 603

DMP1 Protein Vector (Mouse) (pPM-C-His)

PV172445 500 ng
EUR 603

DMP1 Protein Vector (Rat) (pPB-C-His)

PV264302 500 ng
EUR 603

DMP1 Protein Vector (Rat) (pPB-N-His)

PV264303 500 ng
EUR 603

DMP1 Protein Vector (Rat) (pPM-C-HA)

PV264304 500 ng
EUR 603

DMP1 Protein Vector (Rat) (pPM-C-His)

PV264305 500 ng
EUR 603

Dmp1 3'UTR Luciferase Stable Cell Line

TU203470 1.0 ml Ask for price

Dmp1 3'UTR GFP Stable Cell Line

TU155208 1.0 ml Ask for price

DMP1 3'UTR Luciferase Stable Cell Line

TU006089 1.0 ml
EUR 1394

Dmp1 3'UTR Luciferase Stable Cell Line

TU105208 1.0 ml Ask for price

DMP1 3'UTR GFP Stable Cell Line

TU056089 1.0 ml
EUR 1394

Dmp1 3'UTR GFP Stable Cell Line

TU253470 1.0 ml Ask for price

DMP1 ELISA Kit (Human) : 96 Wells (OKEH01476)

OKEH01476 96 Wells
EUR 662
Description: Description of target: Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

Human Dentin Matrix Protein 1 (DMP1) ELISA kit

CSB-E13029h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Dentin Matrix Protein 1 (DMP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Dentin Matrix Protein 1 (DMP1) ELISA kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Dentin Matrix Protein 1 (DMP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Dentin Matrix Protein 1 (DMP1) ELISA Kit

CSB-E14252m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Dentin Matrix Protein 1 (DMP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Dentin Matrix Protein 1 (DMP1) ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Dentin Matrix Protein 1 (DMP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

DMP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV658999 1.0 ug DNA
EUR 682

DMP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV659003 1.0 ug DNA
EUR 682

DMP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV659004 1.0 ug DNA
EUR 682

Recombinant Dog DMP1 Protein, His-SUMO, E.coli-100ug

QP6934-ec-100ug 100ug
EUR 707

Recombinant Dog DMP1 Protein, His-SUMO, E.coli-10ug

QP6934-ec-10ug 10ug
EUR 326

Recombinant Dog DMP1 Protein, His-SUMO, E.coli-1mg

QP6934-ec-1mg 1mg
EUR 2303

Recombinant Dog DMP1 Protein, His-SUMO, E.coli-200ug

QP6934-ec-200ug 200ug
EUR 1115

Recombinant Dog DMP1 Protein, His-SUMO, E.coli-500ug

QP6934-ec-500ug 500ug
EUR 1514

Recombinant Dog DMP1 Protein, His-SUMO, E.coli-50ug

QP6934-ec-50ug 50ug
EUR 435

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC


DMP1 Rabbit Polyclonal Antibody