DMP1 Rabbit Polyclonal Antibody
DMP1 Polyclonal Antibody |
ABP58392-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DMP1 protein at amino acid sequence of 430-510
- Applications tips:
|
Description: A polyclonal antibody for detection of DMP1 from Human. This DMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DMP1 protein at amino acid sequence of 430-510 |
DMP1 Rabbit pAb |
A11076-100ul |
Abclonal |
100 ul |
EUR 308 |
DMP1 Rabbit pAb |
A11076-200ul |
Abclonal |
200 ul |
EUR 459 |
DMP1 Rabbit pAb |
A11076-20ul |
Abclonal |
20 ul |
EUR 183 |
DMP1 Rabbit pAb |
A11076-50ul |
Abclonal |
50 ul |
EUR 223 |
DMP1 Rabbit pAb |
A16832-100ul |
Abclonal |
100 ul |
EUR 308 |
DMP1 Rabbit pAb |
A16832-200ul |
Abclonal |
200 ul |
EUR 459 |
DMP1 Rabbit pAb |
A16832-20ul |
Abclonal |
20 ul |
EUR 183 |
DMP1 Rabbit pAb |
A16832-50ul |
Abclonal |
50 ul |
EUR 223 |
DMP1 antibody |
38779-100ul |
SAB |
100ul |
EUR 252 |
DMP1 antibody |
70R-12137 |
Fitzgerald |
100 ug |
EUR 460 |
Description: Rabbit polyclonal DMP1 antibody |
DMP1 Antibody |
DF8825 |
Affbiotech |
200ul |
EUR 304 |
Description: DMP1 Antibody detects endogenous levels of total DMP1. |
DMP1 Antibody |
1-CSB-PA006967DSR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against DMP1. Recognizes DMP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal DMP1 Antibody (N-term) |
APR15749G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DMP1 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal Goat Anti-DMP1 Antibody |
APR16266G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-DMP1 . This antibody is tested and proven to work in the following applications: |
DMP1 Conjugated Antibody |
C38779 |
SAB |
100ul |
EUR 397 |
Anti-DMP1 antibody |
STJ113700 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene. |
Anti-DMP1 antibody |
STJ190216 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DMP1 |
DMP1 siRNA |
20-abx914272 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DMP1 siRNA |
20-abx914273 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DMP1 cloning plasmid |
CSB-CL006967HU-10ug |
Cusabio |
10ug |
EUR 541 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1542
- Sequence: atgaagatcagcatcctgctcatgttcctttggggattatcctgtgctctcccagtaaccaggtatcaaaataatgaatctgaggattctgaagaatggaagggtcatttggctcaggcaccaacaccacccttggagagcagtgagtcatcagaaggcagtaaagttagctcag
- Show more
|
Description: A cloning plasmid for the DMP1 gene. |
DMP1 Blocking Peptide |
33R-10953 |
Fitzgerald |
50 ug |
EUR 191 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DMP1 antibody, catalog no. 70R-12137 |
DMP1 Blocking Peptide |
3844BP-50 |
Biovision |
|
EUR 153 |
DMP1 Blocking Peptide |
DF8825-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-DMP1 (1D4) |
YF-MA12712 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DMP1 |
Human DMP1 shRNA Plasmid |
20-abx951221 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse DMP1 shRNA Plasmid |
20-abx970022 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Dog Uncharacterized protein (DMP1) |
1-CSB-EP2043DO |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 63.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Dog Uncharacterized protein(DMP1) expressed in E.coli |
DMP1 Recombinant Protein (Human) |
RP038551 |
ABM |
100 ug |
Ask for price |
DMP1 Recombinant Protein (Rat) |
RP198224 |
ABM |
100 ug |
Ask for price |
DMP1 Recombinant Protein (Mouse) |
RP129329 |
ABM |
100 ug |
Ask for price |
Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody |
20-abx125762 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody |
20-abx004775 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody |
abx030674-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody |
abx030674-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody |
20-abx320176 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody |
abx432613-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Dmp1 ORF Vector (Rat) (pORF) |
ORF066076 |
ABM |
1.0 ug DNA |
EUR 506 |
Dmp1 ORF Vector (Mouse) (pORF) |
ORF043111 |
ABM |
1.0 ug DNA |
EUR 506 |
DMP1 ORF Vector (Human) (pORF) |
ORF012851 |
ABM |
1.0 ug DNA |
EUR 354 |
DMP1 ELISA Kit (Rat) (OKCA02543) |
OKCA02543 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: May have a dual function during osteoblast differentiation. In the nucleus of undifferentiated osteoblasts, unphosphorylated form acts as a transcriptional component for activation of osteoblast-specific genes like osteocalcin. During the osteoblast to osteocyte transition phase it is phosphorylated and exported into the extracellular matrix, where it regulates nucleation of hydroxyapatite.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.156 ng/mL |
DMP1 ELISA Kit (Rat) (OKEH06061) |
OKEH06061 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: May have a dual function during osteoblast differentiation. In the nucleus of undifferentiated osteoblasts, unphosphorylated form acts as a transcriptional component for activation of osteoblast-specific genes like osteocalcin. During the osteoblast to osteocyte transition phase it is phosphorylated and exported into the extracellular matrix, where it regulates nucleation of hydroxyapatite.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 41 pg/mL |
DMP1 sgRNA CRISPR Lentivector set (Human) |
K0609601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dmp1 sgRNA CRISPR Lentivector set (Mouse) |
K3915301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dmp1 sgRNA CRISPR Lentivector set (Rat) |
K6816901 |
ABM |
3 x 1.0 ug |
EUR 339 |
DMP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0609602 |
ABM |
1.0 ug DNA |
EUR 154 |
DMP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0609603 |
ABM |
1.0 ug DNA |
EUR 154 |
DMP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0609604 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Dentin matrix acidic phosphoprotein 1 (DMP1) |
1-CSB-YP006967HU |
Cusabio |
-
EUR 586.00
-
EUR 299.00
-
EUR 2172.00
-
EUR 900.00
-
EUR 1442.00
-
EUR 382.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 56 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Dentin matrix acidic phosphoprotein 1(DMP1) expressed in Yeast |
Dmp1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3915302 |
ABM |
1.0 ug DNA |
EUR 154 |
Dmp1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3915303 |
ABM |
1.0 ug DNA |
EUR 154 |
Dmp1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3915304 |
ABM |
1.0 ug DNA |
EUR 154 |
Dmp1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6816902 |
ABM |
1.0 ug DNA |
EUR 154 |
Dmp1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6816903 |
ABM |
1.0 ug DNA |
EUR 154 |
Dmp1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6816904 |
ABM |
1.0 ug DNA |
EUR 154 |
DMP1 Protein Vector (Human) (pPB-C-His) |
PV051401 |
ABM |
500 ng |
EUR 481 |
DMP1 Protein Vector (Human) (pPB-N-His) |
PV051402 |
ABM |
500 ng |
EUR 481 |
DMP1 Protein Vector (Human) (pPM-C-HA) |
PV051403 |
ABM |
500 ng |
EUR 481 |
DMP1 Protein Vector (Human) (pPM-C-His) |
PV051404 |
ABM |
500 ng |
EUR 481 |
DMP1 Protein Vector (Mouse) (pPB-C-His) |
PV172442 |
ABM |
500 ng |
EUR 603 |
DMP1 Protein Vector (Mouse) (pPB-N-His) |
PV172443 |
ABM |
500 ng |
EUR 603 |
DMP1 Protein Vector (Mouse) (pPM-C-HA) |
PV172444 |
ABM |
500 ng |
EUR 603 |
DMP1 Protein Vector (Mouse) (pPM-C-His) |
PV172445 |
ABM |
500 ng |
EUR 603 |
DMP1 Protein Vector (Rat) (pPB-C-His) |
PV264302 |
ABM |
500 ng |
EUR 603 |
DMP1 Protein Vector (Rat) (pPB-N-His) |
PV264303 |
ABM |
500 ng |
EUR 603 |
DMP1 Protein Vector (Rat) (pPM-C-HA) |
PV264304 |
ABM |
500 ng |
EUR 603 |
DMP1 Protein Vector (Rat) (pPM-C-His) |
PV264305 |
ABM |
500 ng |
EUR 603 |
Dmp1 3'UTR Luciferase Stable Cell Line |
TU203470 |
ABM |
1.0 ml |
Ask for price |
Dmp1 3'UTR GFP Stable Cell Line |
TU155208 |
ABM |
1.0 ml |
Ask for price |
DMP1 3'UTR Luciferase Stable Cell Line |
TU006089 |
ABM |
1.0 ml |
EUR 1394 |
Dmp1 3'UTR Luciferase Stable Cell Line |
TU105208 |
ABM |
1.0 ml |
Ask for price |
DMP1 3'UTR GFP Stable Cell Line |
TU056089 |
ABM |
1.0 ml |
EUR 1394 |
Dmp1 3'UTR GFP Stable Cell Line |
TU253470 |
ABM |
1.0 ml |
Ask for price |
DMP1 ELISA Kit (Human) : 96 Wells (OKEH01476) |
OKEH01476 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL |
Human Dentin Matrix Protein 1 (DMP1) ELISA kit |
CSB-E13029h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Dentin Matrix Protein 1 (DMP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Dentin Matrix Protein 1 (DMP1) ELISA kit |
1-CSB-E13029h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Dentin Matrix Protein 1 (DMP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Dentin Matrix Protein 1 (DMP1) ELISA Kit |
CSB-E14252m-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Dentin Matrix Protein 1 (DMP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Dentin Matrix Protein 1 (DMP1) ELISA Kit |
1-CSB-E14252m |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Dentin Matrix Protein 1 (DMP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
DMP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV658999 |
ABM |
1.0 ug DNA |
EUR 682 |
DMP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV659003 |
ABM |
1.0 ug DNA |
EUR 682 |
DMP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV659004 |
ABM |
1.0 ug DNA |
EUR 682 |
Recombinant Dog DMP1 Protein, His-SUMO, E.coli-100ug |
QP6934-ec-100ug |
EnQuireBio |
100ug |
EUR 707 |
Recombinant Dog DMP1 Protein, His-SUMO, E.coli-10ug |
QP6934-ec-10ug |
EnQuireBio |
10ug |
EUR 326 |
Recombinant Dog DMP1 Protein, His-SUMO, E.coli-1mg |
QP6934-ec-1mg |
EnQuireBio |
1mg |
EUR 2303 |
Recombinant Dog DMP1 Protein, His-SUMO, E.coli-200ug |
QP6934-ec-200ug |
EnQuireBio |
200ug |
EUR 1115 |
Recombinant Dog DMP1 Protein, His-SUMO, E.coli-500ug |
QP6934-ec-500ug |
EnQuireBio |
500ug |
EUR 1514 |
Recombinant Dog DMP1 Protein, His-SUMO, E.coli-50ug |
QP6934-ec-50ug |
EnQuireBio |
50ug |
EUR 435 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
DMP1 Rabbit Polyclonal Antibody