CNPY3 Rabbit Polyclonal Antibody

CNPY3 Rabbit Polyclonal Antibody

 

CNPY3 Polyclonal Antibody

ABP58210-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CNPY3 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of CNPY3 from Human, Mouse. This CNPY3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNPY3 protein at amino acid sequence of 1-50

CNPY3 Rabbit pAb

A7176-100ul 100 ul
EUR 308

CNPY3 Rabbit pAb

A7176-200ul 200 ul
EUR 459

CNPY3 Rabbit pAb

A7176-20ul 20 ul
EUR 183

CNPY3 Rabbit pAb

A7176-50ul 50 ul
EUR 223

CNPY3 Antibody

47291-100ul 100ul
EUR 252

CNPY3 Antibody

1-CSB-PA874802ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNPY3. Recognizes CNPY3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CNPY3 Antibody

1-CSB-PA874802ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNPY3. Recognizes CNPY3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Polyclonal CNPY3 Antibody (N-term)

APR04336G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNPY3 (N-term). This antibody is tested and proven to work in the following applications:

CNPY3 Conjugated Antibody

C47291 100ul
EUR 397

anti- CNPY3 antibody

FNab01816 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: canopy 3 homolog (zebrafish)
  • Uniprot ID: Q9BT09
  • Gene ID: 10695
  • Research Area: Neuroscience
Description: Antibody raised against CNPY3

Anti-CNPY3 antibody

PAab01816 100 ug
EUR 355

Anti-CNPY3 antibody

STJ99014 200 µl
EUR 197
Description: Rabbit polyclonal to CNPY3.

Anti-CNPY3 antibody

STJ29256 100 µl
EUR 277
Description: This gene encodes a protein that binds members of the toll-like receptor protein family and functions as a chaperone to aid in folding and export of these proteins. Alternative splicing results in multiple transcript variants. Naturally occuring readthrough transcription occurs between this locus and the downstream GNMT (glycine N-methyltransferase) gene and is represented with GeneID:107080644.

CNPY3 siRNA

20-abx912297
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNPY3 siRNA

20-abx912298
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNPY3 cloning plasmid

CSB-CL874802HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 837
  • Sequence: atggattcaatgcctgagcccgcgtcccgctgtcttctgcttcttcccttgctgctgctgctgctgctgctgctgccggccccggagctgggcccgagccaggccggagctgaggagaacgactgggttcgcctgcccagcaaatgcgaagtgtgtaaatatgttgctgtggagct
  • Show more
Description: A cloning plasmid for the CNPY3 gene.

Canopy 3 Homolog (CNPY3) Antibody

20-abx006907
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

20-abx030445
  • EUR 98.00
  • EUR 133.00
  • EUR 523.00
  • 10 ul
  • 20 ul
  • 400 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

abx030445-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

20-abx320882
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

 

CNPY3 Rabbit Polyclonal Antibody