CHD1 Rabbit Polyclonal Antibody

CHD1 Rabbit Polyclonal Antibody


CHD1 Polyclonal Antibody

ABP58135-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CHD1 protein at amino acid sequence of 960-1040
  • Applications tips:
Description: A polyclonal antibody for detection of CHD1 from Human, Mouse. This CHD1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CHD1 protein at amino acid sequence of 960-1040

CHD1 Polyclonal Antibody

ABP58135-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CHD1 protein at amino acid sequence of 960-1040
  • Applications tips:
Description: A polyclonal antibody for detection of CHD1 from Human, Mouse. This CHD1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CHD1 protein at amino acid sequence of 960-1040

CHD1 Polyclonal Antibody

ES9021-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CHD1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CHD1 Polyclonal Antibody

ES9021-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CHD1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CHD1 Rabbit pAb

A15038-100ul 100 ul
EUR 308

CHD1 Rabbit pAb

A15038-200ul 200 ul
EUR 459

CHD1 Rabbit pAb

A15038-20ul 20 ul
EUR 183

CHD1 Rabbit pAb

A15038-50ul 50 ul
EUR 223

CHD1 Polyclonal Conjugated Antibody

C31368 100ul
EUR 397

CHD1 antibody

70R-16384 50 ul
EUR 435
Description: Rabbit polyclonal CHD1 antibody

CHD1 Antibody

45469-100ul 100ul
EUR 252

CHD1 Antibody

45469-50ul 50ul
EUR 187

CHD1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CHD1. Recognizes CHD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, ChIP; Recommended dilution: IHC:1:20-1:200

CHD1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CHD1. Recognizes CHD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CHD1 Antibody

DF8753 200ul
EUR 304
Description: CHD1 Antibody detects endogenous levels of total CHD1.

CHD1 Antibody

ABD8753 100 ug
EUR 438

[KO Validated] CHD1 Polyclonal Antibody

31368-100ul 100ul
EUR 252

[KO Validated] CHD1 Polyclonal Antibody

31368-50ul 50ul
EUR 187

[KO Validated] CHD1 Rabbit pAb

A7883-100ul 100 ul
EUR 410

[KO Validated] CHD1 Rabbit pAb

A7883-200ul 200 ul
EUR 571

[KO Validated] CHD1 Rabbit pAb

A7883-20ul 20 ul
EUR 221

[KO Validated] CHD1 Rabbit pAb

A7883-50ul 50 ul
EUR 287

CHD1 Conjugated Antibody

C45469 100ul
EUR 397

anti- CHD1 antibody

FNab01640 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:100 - 1:200
  • Immunogen: chromodomain helicase DNA binding protein 1
  • Uniprot ID: O14646
  • Gene ID: 1105
  • Research Area: Stem Cells, Metabolism
Description: Antibody raised against CHD1

Anti-CHD1 antibody

PAab01640 100 ug
EUR 386

Anti-CHD1 antibody

STJ110193 100 µl
EUR 413
Description: The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template.

Anti-CHD1 antibody

STJ117232 100 µl
EUR 277
Description: The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template.

Anti-CHD1 antibody

STJ190179 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CHD1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA23444 50 ul
EUR 334
Description: Mouse polyclonal to CHD1

Anti-CHD1 (internal) antibody

STJ71194 100 µg
EUR 260

CHD1 Blocking Peptide

DF8753-BP 1mg
EUR 195

CHD1 cloning plasmid

CSB-CL005325HU-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5130
  • Sequence: atgaatggacacagtgatgaagaaagtgttagaaacagtagtggagaatcaagccagtcggatgatgattctgggtcagcttcaggctctggatctggttcgagttctggaagcagtagtgatggaagcagtagccagtcaggtagcagtgactctgactccggatctgaatcag
  • Show more
Description: A cloning plasmid for the CHD1 gene.

Anti-CHD1 (1G2)

YF-MA12434 50 ug
EUR 363
Description: Mouse monoclonal to CHD1

Chromodomain helicase DNA binding protein 1 (CHD1) polyclonal antibody

ABP-'PAB-10568 100 ug Ask for price
    • Product line: Genetic Disease Markers
    • Brand:

Chromodomain helicase DNA binding protein 1 (Chd1) polyclonal antibody

ABP-PAB-10569 100 ug Ask for price
    • Product line: Genetic Disease Markers
    • Brand:

Mouse Chd1 ELISA KIT

ELI-11179m 96 Tests
EUR 865


ELI-25745h 96 Tests
EUR 824


EF008630 96 Tests
EUR 689

Mouse CHD1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CHD1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-50729c 96 Tests
EUR 928

Chd1 ORF Vector (Rat) (pORF)

ORF064933 1.0 ug DNA
EUR 2080

CHD1 ORF Vector (Human) (pORF)

ORF012676 1.0 ug DNA
EUR 95

Chd1 ORF Vector (Mouse) (pORF)

ORF041283 1.0 ug DNA
EUR 1572

pECMV-Chd1-m-FLAG Plasmid

PVT15589 2 ug
EUR 325

Rabbit Chromodomain helicase DNA binding protein 1(CHD1) ELISA kit

E04C1664-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chromodomain helicase DNA binding protein 1(CHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chromodomain helicase DNA binding protein 1(CHD1) ELISA kit

E04C1664-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chromodomain helicase DNA binding protein 1(CHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chromodomain helicase DNA binding protein 1(CHD1) ELISA kit

E04C1664-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chromodomain helicase DNA binding protein 1(CHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody

abx431160-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody

abx231640-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Chd1 sgRNA CRISPR Lentivector set (Mouse)

K4881901 3 x 1.0 ug
EUR 339

CHD1 sgRNA CRISPR Lentivector set (Human)

K0442601 3 x 1.0 ug
EUR 339

Chd1 sgRNA CRISPR Lentivector set (Rat)

K6344201 3 x 1.0 ug
EUR 339

Chd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4881902 1.0 ug DNA
EUR 154

Chd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4881903 1.0 ug DNA
EUR 154

Chd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4881904 1.0 ug DNA
EUR 154

CHD1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0442602 1.0 ug DNA
EUR 154

CHD1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0442603 1.0 ug DNA
EUR 154

CHD1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0442604 1.0 ug DNA
EUR 154

Chd1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6344202 1.0 ug DNA
EUR 154

Chd1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6344203 1.0 ug DNA
EUR 154

Chd1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6344204 1.0 ug DNA
EUR 154

CHD1 Protein Vector (Mouse) (pPB-C-His)

PV165130 500 ng
EUR 2859

CHD1 Protein Vector (Mouse) (pPB-N-His)

PV165131 500 ng
EUR 2859

CHD1 Protein Vector (Mouse) (pPM-C-HA)

PV165132 500 ng
EUR 2859

CHD1 Protein Vector (Mouse) (pPM-C-His)

PV165133 500 ng
EUR 2859

CHD1 Protein Vector (Rat) (pPB-C-His)

PV259730 500 ng
EUR 2859

CHD1 Protein Vector (Rat) (pPB-N-His)

PV259731 500 ng
EUR 2859

CHD1 Protein Vector (Rat) (pPM-C-HA)

PV259732 500 ng
EUR 2859

CHD1 Protein Vector (Rat) (pPM-C-His)

PV259733 500 ng
EUR 2859

CHD1 Protein Vector (Human) (pPB-C-His)

PV050701 500 ng
EUR 481

CHD1 Protein Vector (Human) (pPB-N-His)

PV050702 500 ng
EUR 481

CHD1 Protein Vector (Human) (pPM-C-HA)

PV050703 500 ng
EUR 481

CHD1 Protein Vector (Human) (pPM-C-His)

PV050704 500 ng
EUR 481

Chd1 3'UTR GFP Stable Cell Line

TU153812 1.0 ml Ask for price

Chd1 3'UTR Luciferase Stable Cell Line

TU103812 1.0 ml Ask for price

Chd1 3'UTR Luciferase Stable Cell Line

TU202264 1.0 ml Ask for price

Chd1 3'UTR GFP Stable Cell Line

TU252264 1.0 ml Ask for price

CHD1 3'UTR GFP Stable Cell Line

TU054327 1.0 ml
EUR 1394

CHD1 3'UTR Luciferase Stable Cell Line

TU004327 1.0 ml
EUR 1394

CHD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV669667 1.0 ug DNA
EUR 2665

CHD1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV669671 1.0 ug DNA
EUR 2665

CHD1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV669672 1.0 ug DNA
EUR 2665

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187


CHD1 Rabbit Polyclonal Antibody