CHD1 Rabbit Polyclonal Antibody
CHD1 Polyclonal Antibody |
ABP58135-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CHD1 protein at amino acid sequence of 960-1040
- Applications tips:
|
Description: A polyclonal antibody for detection of CHD1 from Human, Mouse. This CHD1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CHD1 protein at amino acid sequence of 960-1040 |
CHD1 Polyclonal Antibody |
ABP58135-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CHD1 protein at amino acid sequence of 960-1040
- Applications tips:
|
Description: A polyclonal antibody for detection of CHD1 from Human, Mouse. This CHD1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CHD1 protein at amino acid sequence of 960-1040 |
CHD1 Polyclonal Antibody |
ES9021-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CHD1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CHD1 Polyclonal Antibody |
ES9021-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CHD1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CHD1 Rabbit pAb |
A15038-100ul |
Abclonal |
100 ul |
EUR 308 |
CHD1 Rabbit pAb |
A15038-200ul |
Abclonal |
200 ul |
EUR 459 |
CHD1 Rabbit pAb |
A15038-20ul |
Abclonal |
20 ul |
EUR 183 |
CHD1 Rabbit pAb |
A15038-50ul |
Abclonal |
50 ul |
EUR 223 |
CHD1 Polyclonal Conjugated Antibody |
C31368 |
SAB |
100ul |
EUR 397 |
CHD1 antibody |
70R-16384 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CHD1 antibody |
CHD1 Antibody |
45469-100ul |
SAB |
100ul |
EUR 252 |
CHD1 Antibody |
45469-50ul |
SAB |
50ul |
EUR 187 |
CHD1 Antibody |
1-CSB-PA005325ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CHD1. Recognizes CHD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, ChIP; Recommended dilution: IHC:1:20-1:200 |
CHD1 Antibody |
1-CSB-PA005325GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against CHD1. Recognizes CHD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
CHD1 Antibody |
DF8753 |
Affbiotech |
200ul |
EUR 304 |
Description: CHD1 Antibody detects endogenous levels of total CHD1. |
[KO Validated] CHD1 Polyclonal Antibody |
31368-100ul |
SAB |
100ul |
EUR 252 |
[KO Validated] CHD1 Polyclonal Antibody |
31368-50ul |
SAB |
50ul |
EUR 187 |
[KO Validated] CHD1 Rabbit pAb |
A7883-100ul |
Abclonal |
100 ul |
EUR 410 |
[KO Validated] CHD1 Rabbit pAb |
A7883-200ul |
Abclonal |
200 ul |
EUR 571 |
[KO Validated] CHD1 Rabbit pAb |
A7883-20ul |
Abclonal |
20 ul |
EUR 221 |
[KO Validated] CHD1 Rabbit pAb |
A7883-50ul |
Abclonal |
50 ul |
EUR 287 |
CHD1 Conjugated Antibody |
C45469 |
SAB |
100ul |
EUR 397 |
anti- CHD1 antibody |
FNab01640 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:100 - 1:200
- Immunogen: chromodomain helicase DNA binding protein 1
- Uniprot ID: O14646
- Gene ID: 1105
- Research Area: Stem Cells, Metabolism
|
Description: Antibody raised against CHD1 |
Anti-CHD1 antibody |
STJ110193 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. |
Anti-CHD1 antibody |
STJ117232 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. |
Anti-CHD1 antibody |
STJ190179 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CHD1 |
CHD1 siRNA |
20-abx911659 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CHD1 siRNA |
20-abx911660 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CHD1 |
YF-PA23444 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to CHD1 |
CHD1 Blocking Peptide |
DF8753-BP |
Affbiotech |
1mg |
EUR 195 |
CHD1 cloning plasmid |
CSB-CL005325HU-10ug |
Cusabio |
10ug |
EUR 2770 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 5130
- Sequence: atgaatggacacagtgatgaagaaagtgttagaaacagtagtggagaatcaagccagtcggatgatgattctgggtcagcttcaggctctggatctggttcgagttctggaagcagtagtgatggaagcagtagccagtcaggtagcagtgactctgactccggatctgaatcag
- Show more
|
Description: A cloning plasmid for the CHD1 gene. |
Anti-CHD1 (1G2) |
YF-MA12434 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to CHD1 |
Chromodomain helicase DNA binding protein 1 (CHD1) polyclonal antibody |
ABP-'PAB-10568 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Genetic Disease Markers
- Brand:
|
Chromodomain helicase DNA binding protein 1 (Chd1) polyclonal antibody |
ABP-PAB-10569 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Genetic Disease Markers
- Brand:
|
Mouse CHD1 shRNA Plasmid |
20-abx969659 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CHD1 shRNA Plasmid |
20-abx950787 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Chd1 ORF Vector (Rat) (pORF) |
ORF064933 |
ABM |
1.0 ug DNA |
EUR 2080 |
CHD1 ORF Vector (Human) (pORF) |
ORF012676 |
ABM |
1.0 ug DNA |
EUR 95 |
Chd1 ORF Vector (Mouse) (pORF) |
ORF041283 |
ABM |
1.0 ug DNA |
EUR 1572 |
Rabbit Chromodomain helicase DNA binding protein 1(CHD1) ELISA kit |
E04C1664-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Chromodomain helicase DNA binding protein 1(CHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Chromodomain helicase DNA binding protein 1(CHD1) ELISA kit |
E04C1664-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Chromodomain helicase DNA binding protein 1(CHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Chromodomain helicase DNA binding protein 1(CHD1) ELISA kit |
E04C1664-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Chromodomain helicase DNA binding protein 1(CHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody |
20-abx006569 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody |
20-abx111636 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody |
20-abx149277 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody |
20-abx321745 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody |
abx431160-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody |
abx231640-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Chd1 sgRNA CRISPR Lentivector set (Mouse) |
K4881901 |
ABM |
3 x 1.0 ug |
EUR 339 |
CHD1 sgRNA CRISPR Lentivector set (Human) |
K0442601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Chd1 sgRNA CRISPR Lentivector set (Rat) |
K6344201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Chd1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4881902 |
ABM |
1.0 ug DNA |
EUR 154 |
Chd1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4881903 |
ABM |
1.0 ug DNA |
EUR 154 |
Chd1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4881904 |
ABM |
1.0 ug DNA |
EUR 154 |
CHD1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0442602 |
ABM |
1.0 ug DNA |
EUR 154 |
CHD1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0442603 |
ABM |
1.0 ug DNA |
EUR 154 |
CHD1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0442604 |
ABM |
1.0 ug DNA |
EUR 154 |
Chd1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6344202 |
ABM |
1.0 ug DNA |
EUR 154 |
Chd1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6344203 |
ABM |
1.0 ug DNA |
EUR 154 |
Chd1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6344204 |
ABM |
1.0 ug DNA |
EUR 154 |
CHD1 Protein Vector (Mouse) (pPB-C-His) |
PV165130 |
ABM |
500 ng |
EUR 2859 |
CHD1 Protein Vector (Mouse) (pPB-N-His) |
PV165131 |
ABM |
500 ng |
EUR 2859 |
CHD1 Protein Vector (Mouse) (pPM-C-HA) |
PV165132 |
ABM |
500 ng |
EUR 2859 |
CHD1 Protein Vector (Mouse) (pPM-C-His) |
PV165133 |
ABM |
500 ng |
EUR 2859 |
CHD1 Protein Vector (Rat) (pPB-C-His) |
PV259730 |
ABM |
500 ng |
EUR 2859 |
CHD1 Protein Vector (Rat) (pPB-N-His) |
PV259731 |
ABM |
500 ng |
EUR 2859 |
CHD1 Protein Vector (Rat) (pPM-C-HA) |
PV259732 |
ABM |
500 ng |
EUR 2859 |
CHD1 Protein Vector (Rat) (pPM-C-His) |
PV259733 |
ABM |
500 ng |
EUR 2859 |
CHD1 Protein Vector (Human) (pPB-C-His) |
PV050701 |
ABM |
500 ng |
EUR 481 |
CHD1 Protein Vector (Human) (pPB-N-His) |
PV050702 |
ABM |
500 ng |
EUR 481 |
CHD1 Protein Vector (Human) (pPM-C-HA) |
PV050703 |
ABM |
500 ng |
EUR 481 |
CHD1 Protein Vector (Human) (pPM-C-His) |
PV050704 |
ABM |
500 ng |
EUR 481 |
Chd1 3'UTR GFP Stable Cell Line |
TU153812 |
ABM |
1.0 ml |
Ask for price |
Chd1 3'UTR Luciferase Stable Cell Line |
TU103812 |
ABM |
1.0 ml |
Ask for price |
Chd1 3'UTR Luciferase Stable Cell Line |
TU202264 |
ABM |
1.0 ml |
Ask for price |
Chd1 3'UTR GFP Stable Cell Line |
TU252264 |
ABM |
1.0 ml |
Ask for price |
CHD1 3'UTR GFP Stable Cell Line |
TU054327 |
ABM |
1.0 ml |
EUR 1394 |
CHD1 3'UTR Luciferase Stable Cell Line |
TU004327 |
ABM |
1.0 ml |
EUR 1394 |
CHD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV669667 |
ABM |
1.0 ug DNA |
EUR 2665 |
CHD1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV669671 |
ABM |
1.0 ug DNA |
EUR 2665 |
CHD1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV669672 |
ABM |
1.0 ug DNA |
EUR 2665 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
CHD1 Rabbit Polyclonal Antibody