CD70 Rabbit Polyclonal Antibody
CD70 Polyclonal Antibody |
ABP58073-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CD70 protein at amino acid sequence of 150-193
- Applications tips:
|
Description: A polyclonal antibody for detection of CD70 from Human, Mouse. This CD70 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD70 protein at amino acid sequence of 150-193 |
CD70 Polyclonal Antibody |
ABP58073-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CD70 protein at amino acid sequence of 150-193
- Applications tips:
|
Description: A polyclonal antibody for detection of CD70 from Human, Mouse. This CD70 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD70 protein at amino acid sequence of 150-193 |
CD70 Polyclonal Antibody |
ABP58073-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CD70 protein at amino acid sequence of 150-193
- Applications tips:
|
Description: A polyclonal antibody for detection of CD70 from Human, Mouse. This CD70 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD70 protein at amino acid sequence of 150-193 |
CD70 Polyclonal Antibody |
ABP50916-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CD70 at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of CD70 from Human. This CD70 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD70 at AA range: 40-120 |
CD70 Polyclonal Antibody |
ABP50916-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CD70 at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of CD70 from Human. This CD70 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD70 at AA range: 40-120 |
CD70 Polyclonal Antibody |
ABP50916-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CD70 at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of CD70 from Human. This CD70 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD70 at AA range: 40-120 |
CD70 Polyclonal Antibody |
40704-100ul |
SAB |
100ul |
EUR 252 |
CD70 Polyclonal Antibody |
40704-50ul |
SAB |
50ul |
EUR 187 |
Rabbit CD70 antigen(CD70) ELISA kit |
E04C1493-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit CD70 antigen(CD70) ELISA kit |
E04C1493-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit CD70 antigen(CD70) ELISA kit |
E04C1493-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
CD70 Rabbit pAb |
A2032-100ul |
Abclonal |
100 ul |
EUR 308 |
CD70 Rabbit pAb |
A2032-200ul |
Abclonal |
200 ul |
EUR 459 |
CD70 Rabbit pAb |
A2032-20ul |
Abclonal |
20 ul |
EUR 183 |
CD70 Rabbit pAb |
A2032-50ul |
Abclonal |
50 ul |
EUR 223 |
CD70 Rabbit pAb |
A16698-100ul |
Abclonal |
100 ul |
EUR 308 |
CD70 Rabbit pAb |
A16698-200ul |
Abclonal |
200 ul |
EUR 459 |
CD70 Rabbit pAb |
A16698-20ul |
Abclonal |
20 ul |
EUR 183 |
CD70 Rabbit pAb |
A16698-50ul |
Abclonal |
50 ul |
EUR 223 |
CD70 Rabbit pAb |
A16809-100ul |
Abclonal |
100 ul |
EUR 308 |
CD70 Rabbit pAb |
A16809-200ul |
Abclonal |
200 ul |
EUR 459 |
CD70 Rabbit pAb |
A16809-20ul |
Abclonal |
20 ul |
EUR 183 |
CD70 Rabbit pAb |
A16809-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal CD70 Antibody (Center) |
APR04006G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CD70 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal CD27L / CD70 Antibody (Internal) |
APR02113G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CD27L / CD70 (Internal). This antibody is tested and proven to work in the following applications: |
CD70 Antibody |
AF5265 |
Affbiotech |
200ul |
EUR 304 |
Description: CD70 Antibody detects endogenous levels of total CD70. |
CD70 antibody |
70R-49507 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal CD70 antibody |
CD70 Antibody |
35213-100ul |
SAB |
100ul |
EUR 252 |
CD70 Antibody |
35213-50ul |
SAB |
50ul |
EUR 187 |
CD70 Antibody |
43184-100ul |
SAB |
100ul |
EUR 252 |
CD70 antibody |
10-2490 |
Fitzgerald |
100 ug |
EUR 241 |
Description: Mouse monoclonal CD70 antibody |
CD70 antibody |
10R-6434 |
Fitzgerald |
100 ug |
EUR 192 |
Description: Rat monoclonal CD70 antibody |
CD70 antibody |
10R-CD70bHU |
Fitzgerald |
100 ug |
EUR 404 |
Description: Mouse monoclonal CD70 antibody |
CD70 Antibody |
32562-100ul |
SAB |
100ul |
EUR 252 |
CD70 antibody |
70R-13191 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal CD70 antibody |
CD70 antibody |
70R-10290 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal CD70 antibody |
CD70 Antibody |
DF4696 |
Affbiotech |
200ul |
EUR 304 |
Description: CD70 Antibody detects endogenous levels of total CD70. |
CD70 Antibody |
DF6766 |
Affbiotech |
200ul |
EUR 304 |
Description: CD70 Antibody detects endogenous levels of total CD70. |
CD70 Antibody |
1-CSB-PA001476 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000 |
CD70 Antibody |
CSB-PA004954KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
CD70 Antibody |
CSB-PA004954KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
CD70 Antibody |
1-CSB-PA615999 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
CD70 Antibody |
1-CSB-PA08009A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
CD70 Antibody |
CSB-PA095181- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
CD70 Antibody |
CSB-PA095181-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
CD70 Antibody |
1-CSB-PA068483 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150 |
Human CD70 antigen (CD70) |
1-CSB-YP004954HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 19.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human CD70 antigen(CD70),partial expressed in Yeast |
CD70(BU69) Antibody |
BNC610187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), CF660R conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC610187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), CF660R conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC680187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), CF568 conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC680187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), CF568 conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC430187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), CF543 conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC430187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), CF543 conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC550187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), CF555 conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC550187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), CF555 conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC040187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), CF405S conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC040187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), CF405S conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC400187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), CF640R conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC400187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), CF640R conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC050187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), CF405M conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC050187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), CF405M conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC470187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), CF647 conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC470187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), CF647 conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNUM0187-50 |
Biotium |
50uL |
EUR 395 |
Description: Primary antibody against CD70(BU69), 1mg/mL |
CD70(BU69) Antibody |
BNC700187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), CF770 conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC700187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), CF770 conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC940187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), CF594 conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC940187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), CF594 conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNCH0187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNCH0187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC800187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), CF680 conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC800187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), CF680 conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC810187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), CF680R conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC810187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), CF680R conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNCP0187-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against CD70(BU69), PerCP conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNCR0187-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against CD70(BU69), RPE conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNCA0187-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against CD70(BU69), APC conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNCAP0187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNCAP0187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNCB0187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), Biotin conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNCB0187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), Biotin conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC880187-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(BU69), CF488A conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNC880187-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(BU69), CF488A conjugate, Concentration: 0.1mg/mL |
CD70(BU69) Antibody |
BNUB0187-100 |
Biotium |
100uL |
EUR 209 |
Description: Primary antibody against CD70(BU69), Concentration: 0.2mg/mL |
CD70(BU69) Antibody |
BNUB0187-500 |
Biotium |
500uL |
EUR 458 |
Description: Primary antibody against CD70(BU69), Concentration: 0.2mg/mL |
Human CD70 Antibody |
33274-05111 |
AssayPro |
150 ug |
EUR 261 |
CD70 antibody (PE) |
61R-1271 |
Fitzgerald |
100 ug |
EUR 354 |
Description: Rat monoclonal CD70 antibody (PE) |
CD70 antibody (FITC) |
61R-CD70bHUFT |
Fitzgerald |
120 tests |
EUR 403 |
Description: Mouse monoclonal CD70 antibody (FITC) |
CD70 antibody (PE) |
61R-CD70bHUPE |
Fitzgerald |
120 tests |
EUR 629 |
Description: Mouse monoclonal CD70 antibody (PE) |
Anti-CD70 antibody |
STJ92139 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to CD70. |
Anti-CD70 antibody |
STJ98994 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to CD70. |
Anti-CD70 antibody |
STJ23009 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF27/CD27. It is a surface antigen on activated, but not on resting, T and B lymphocytes. It induces proliferation of costimulated T cells, enhances the generation of cytolytic T cells, and contributes to T cell activation. This cytokine is also reported to play a role in regulating B-cell activation, cytotoxic function of natural killer cells, and immunoglobulin sythesis. |
Human CD70/ CD70 antigen ELISA Kit |
E0439Hu |
Sunlong |
1 Kit |
EUR 605 |
Goat CD70 antigen(CD70) ELISA kit |
E06C1493-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat CD70 antigen(CD70) ELISA kit |
E06C1493-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat CD70 antigen(CD70) ELISA kit |
E06C1493-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat CD70 antigen(CD70) ELISA kit |
E02C1493-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat CD70 antigen(CD70) ELISA kit |
E02C1493-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat CD70 antigen(CD70) ELISA kit |
E02C1493-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse CD70 antigen(CD70) ELISA kit |
E03C1493-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse CD70 antigen(CD70) ELISA kit |
E03C1493-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse CD70 antigen(CD70) ELISA kit |
E03C1493-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human CD70 antigen(CD70) ELISA kit |
E01C1493-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human CD70 antigen(CD70) ELISA kit |
E01C1493-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human CD70 antigen(CD70) ELISA kit |
E01C1493-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig CD70 antigen(CD70) ELISA kit |
E07C1493-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig CD70 antigen(CD70) ELISA kit |
E07C1493-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig CD70 antigen(CD70) ELISA kit |
E07C1493-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog CD70 antigen(CD70) ELISA kit |
E08C1493-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog CD70 antigen(CD70) ELISA kit |
E08C1493-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog CD70 antigen(CD70) ELISA kit |
E08C1493-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey CD70 antigen(CD70) ELISA kit |
E09C1493-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey CD70 antigen(CD70) ELISA kit |
E09C1493-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey CD70 antigen(CD70) ELISA kit |
E09C1493-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human CD70 antigen(CD70) ELISA kit |
CSB-EL004954HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human CD70 antigen (CD70) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human CD70 antigen(CD70) ELISA kit |
1-CSB-EL004954HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human CD70 antigen(CD70) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse CD70 antigen(CD70) ELISA kit |
CSB-EL004954MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse CD70 antigen (CD70) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse CD70 antigen(CD70) ELISA kit |
1-CSB-EL004954MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse CD70 antigen(CD70) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
CD70 siRNA |
20-abx911065 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD70 siRNA |
20-abx911066 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CD70 |
YF-PA10815 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CD70 |
anti-CD70 |
YF-PA10816 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to CD70 |
CD70(TNFS7/1026) Antibody |
BNC611026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), CF660R conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC611026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), CF660R conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC401026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), CF640R conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC401026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), CF640R conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC431026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), CF543 conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC431026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), CF543 conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC471026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), CF647 conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC471026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), CF647 conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC551026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), CF555 conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC551026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), CF555 conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC051026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), CF405M conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC051026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), CF405M conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC041026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), CF405S conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC041026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), CF405S conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNUB1026-100 |
Biotium |
100uL |
EUR 209 |
Description: Primary antibody against CD70(TNFS7/1026), Concentration: 0.2mg/mL |
CD70(TNFS7/1026) Antibody |
BNUB1026-500 |
Biotium |
500uL |
EUR 458 |
Description: Primary antibody against CD70(TNFS7/1026), Concentration: 0.2mg/mL |
CD70(TNFS7/1026) Antibody |
BNUM1026-50 |
Biotium |
50uL |
EUR 395 |
Description: Primary antibody against CD70(TNFS7/1026), 1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC681026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), CF568 conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC681026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), CF568 conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC701026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), CF770 conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC701026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), CF770 conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC941026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), CF594 conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC941026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), CF594 conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNCH1026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNCH1026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC801026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), CF680 conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC801026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), CF680 conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNCP1026-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against CD70(TNFS7/1026), PerCP conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNCR1026-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against CD70(TNFS7/1026), RPE conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNCA1026-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against CD70(TNFS7/1026), APC conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNCAP1026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNCAP1026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNCB1026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), Biotin conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNCB1026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), Biotin conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC881026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), CF488A conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC881026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), CF488A conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC811026-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against CD70(TNFS7/1026), CF680R conjugate, Concentration: 0.1mg/mL |
CD70(TNFS7/1026) Antibody |
BNC811026-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against CD70(TNFS7/1026), CF680R conjugate, Concentration: 0.1mg/mL |
Anti-CD70/Cd27L Antibody |
A02853 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal CD70/Cd27L Antibody. Validated in WB and tested in Human. |
CD70 antibody (Preservative Free) |
10R-CD70bHUP |
Fitzgerald |
100 ug |
EUR 1448 |
Description: Mouse monoclonal CD70 antibody (Preservative Free) |
CD27L (CD27L (CD70)) antibody |
22409-100ul |
SAB |
100ul |
EUR 390 |
CD70 Antibody, HRP conjugated |
1-CSB-PA08009B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CD70 Antibody, FITC conjugated |
1-CSB-PA08009C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CD70 Antibody, Biotin conjugated |
1-CSB-PA08009D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human CD70 Antigen / TNFSF7 (CD70) ELISA Kit |
abx555551-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Mouse CD70 Antigen / TNFSF7 (CD70) ELISA Kit |
abx555613-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Pig CD70 Antigen / TNFSF7 (CD70) ELISA Kit |
abx555675-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Guinea pig CD70 antigen(CD70) ELISA kit |
E05C1493-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig CD70 antigen(CD70) ELISA kit |
E05C1493-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig CD70 antigen(CD70) ELISA kit |
E05C1493-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human CD70 Antigen / TNFSF7 (CD70) ELISA Kit |
20-abx153329 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human CD70 Antibody (Biotin Conjugate) |
33274-05121 |
AssayPro |
150 ug |
EUR 369 |
CD70 Blocking Peptide |
AF5265-BP |
Affbiotech |
1mg |
EUR 195 |
CD70 cloning plasmid |
CSB-CL004954HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 582
- Sequence: atgccggaggagggttcgggctgctcggtgcggcgcaggccctatgggtgcgtcctgcgggctgctttggtcccattggtcgcgggcttggtgatctgcctcgtggtgtgcatccagcgcttcgcacaggctcagcagcagctgccgctcgagtcacttgggtgggacgtagctga
- Show more
|
Description: A cloning plasmid for the CD70 gene. |
CD70 Blocking Peptide |
20-abx062382 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD70 Blocking Peptide |
33R-10423 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD70 antibody, catalog no. 70R-10290 |
CD70 Blocking Peptide |
DF4696-BP |
Affbiotech |
1mg |
EUR 195 |
CD70 Blocking Peptide |
DF6766-BP |
Affbiotech |
1mg |
EUR 195 |
Cluster of Differentiation 70 (CD70) Antibody |
abx117179-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Cluster of Differentiation 70 (CD70) Antibody |
20-abx001649 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Cluster of Differentiation 70 (CD70) Antibody |
abx139325-01mg |
Abbexa |
0.1 mg |
EUR 356 |
- Shipped within 5-12 working days.
|
Cluster of Differentiation 70 (CD70) Antibody |
20-abx009469 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Cluster of Differentiation 70 (CD70) Antibody |
abx028268-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Cluster of Differentiation 70 (CD70) Antibody |
abx028268-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Cluster of Differentiation 70 (CD70) Antibody |
20-abx015078 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Cluster of Differentiation 70 (CD70) Antibody |
20-abx323908 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cluster of Differentiation 70 (CD70) Antibody |
abx330868-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Cluster of Differentiation 70 (CD70) Antibody |
abx413338-02mg |
Abbexa |
0.2 mg |
EUR 565 |
|
Cluster of Differentiation 70 (CD70) Antibody |
abx413339-25ug |
Abbexa |
25 ug |
EUR 272 |
|
Cluster Of Differentiation 70 (CD70) Antibody |
20-abx300992 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cluster of Differentiation 70 (CD70) Antibody |
20-abx210301 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cluster of Differentiation 70 (CD70) Antibody |
20-abx210634 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human CD70 AssayLite Antibody (FITC Conjugate) |
33274-05141 |
AssayPro |
150 ug |
EUR 428 |
Human CD70 AssayLite Antibody (RPE Conjugate) |
33274-05151 |
AssayPro |
150 ug |
EUR 428 |
Human CD70 AssayLite Antibody (APC Conjugate) |
33274-05161 |
AssayPro |
150 ug |
EUR 428 |
Human CD70 AssayLite Antibody (PerCP Conjugate) |
33274-05171 |
AssayPro |
150 ug |
EUR 471 |
Anti-CD70-DM1 ADC |
ADC-W-567 |
Creative Biolabs |
1mg |
Ask for price |
Description: This ADC product is comprised of an anti-CD70 monoclonal antibody conjugated via a linker to DM1 |
Human CD70 shRNA Plasmid |
20-abx950691 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CD70 protein (His tag) |
80R-4132 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Recombinant Human CD70 protein (His tag) |
Anti-Hu CD70 PE |
1P-154-T025 |
ExBio |
25 tests |
EUR 140 |
Anti-Hu CD70 PE |
1P-154-T100 |
ExBio |
100 tests |
EUR 240 |
Anti-Hu CD70 Purified |
11-154-C025 |
ExBio |
0.025 mg |
EUR 99 |
Anti-Hu CD70 Purified |
11-154-C100 |
ExBio |
0.1 mg |
EUR 158 |
Mouse CD70 shRNA Plasmid |
20-abx973169 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CD70 Recombinant Protein (Human) |
RP006409 |
ABM |
100 ug |
Ask for price |
Recombinant Human CD70 Protein |
RP01129 |
Abclonal |
5 μg |
EUR 145 |
CD70 Recombinant Protein (Rat) |
RP194018 |
ABM |
100 ug |
Ask for price |
CD70 Recombinant Protein (Mouse) |
RP122681 |
ABM |
100 ug |
Ask for price |
Cluster of Differentiation 70 (CD70) Antibody (PE) |
abx139326-100tests |
Abbexa |
100 tests |
EUR 481 |
- Shipped within 5-12 working days.
|
Cluster Of Differentiation 70 (CD70) Antibody (HRP) |
20-abx314413 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cluster Of Differentiation 70 (CD70) Antibody (FITC) |
20-abx314414 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cluster Of Differentiation 70 (CD70) Antibody (Biotin) |
20-abx314415 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cluster of Differentiation 70 (CD70) Antibody (RPE) |
abx414005-100tests |
Abbexa |
100 tests |
EUR 592 |
|
Anti-CD70-VC-rachelmycin ADC |
ADC-W-367 |
Creative Biolabs |
1mg |
Ask for price |
Description: This ADC product is comprised of an anti-CD70 monoclonal antibody conjugated via a VC linker to a rachelmycin |
Anti-CD70-MCC-DM1 ADC |
ADC-W-487 |
Creative Biolabs |
1mg |
Ask for price |
Description: This ADC product is comprised of an anti-CD70 monoclonal antibody conjugated via a MCC linker to DM1 |
CD70 Rabbit Polyclonal Antibody