ATG10 Rabbit Polyclonal Antibody

ATG10 Rabbit Polyclonal Antibody


ATG10 Polyclonal Antibody

A67182 100 µg
EUR 570.55
Description: Ask the seller for details

ATG10 Polyclonal Antibody

ABP57837-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of ATG10 from Human. This ATG10 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50

ATG10 Polyclonal Antibody

ABP57837-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of ATG10 from Human. This ATG10 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50

ATG10 Polyclonal Antibody

ABP57837-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of ATG10 from Human. This ATG10 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50

ATG10 Polyclonal Antibody

ES8763-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG10 from Human. This antibody is tested and validated for IHC, WB, ELISA

ATG10 Polyclonal Antibody

ES8763-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG10 from Human. This antibody is tested and validated for IHC, WB, ELISA

ATG10 Rabbit pAb

A7390-100ul 100 ul
EUR 308

ATG10 Rabbit pAb

A7390-200ul 200 ul
EUR 459

ATG10 Rabbit pAb

A7390-20ul 20 ul
EUR 183

ATG10 Rabbit pAb

A7390-50ul 50 ul
EUR 223

Polyclonal APG10/ATG10 Antibody

APR00221G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human APG10/ATG10 . This antibody is tested and proven to work in the following applications:

ATG10 Polyclonal Conjugated Antibody

C46882 100ul
EUR 397

ATG10 Antibody

24607-100ul 100ul
EUR 390

ATG10 antibody

70R-12183 100 ug
EUR 447
Description: Rabbit polyclonal ATG10 antibody

ATG10 Antibody

36115-100ul 100ul
EUR 252

ATG10 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

ATG10 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ATG10 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

ATG10 Antibody

DF8366 200ul
EUR 304
Description: ATG10 Antibody detects endogenous levels of total ATG10.

ATG10 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

ATG10 antibody

70R-3584 50 ug
EUR 467
Description: Rabbit polyclonal ATG10 antibody

ATG10 Antibody

ABD8366 100 ug
EUR 438

Polyclonal ATG10 Antibody (N-term)

APR07066G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG10 (N-term). This antibody is tested and proven to work in the following applications:

ATG10 Polyclonal Antibody, HRP Conjugated

A67183 100 µg
EUR 570.55
Description: The best epigenetics products

ATG10 Polyclonal Antibody, FITC Conjugated

A67184 100 µg
EUR 570.55
Description: kits suitable for this type of research

ATG10 Polyclonal Antibody, Biotin Conjugated

A67185 100 µg
EUR 570.55
Description: fast delivery possible

Anti-Apg10 (Atg10) Rabbit Monoclonal Antibody

M07803 100ug/vial
EUR 397
Description: Rabbit Monoclonal Apg10 (Atg10) Antibody. Validated in IP, WB and tested in Human.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody

abx448529-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human ATG10 Antibody

32244-05111 150 ug
EUR 261

APG10/ATG10 Antibody

EUR 338

ATG10 Conjugated Antibody

C36115 100ul
EUR 397

ATG10 Antibody (Biotin)

abx447701-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

ATG10 Antibody (FITC)

abx447702-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

ATG10 Antibody (HRP)

abx447703-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Anti-ATG10 antibody

STJ29527 100 µl
EUR 277

Anti-ATG10 antibody

STJ98826 200 µl
EUR 197
Description: Rabbit polyclonal to ATG10.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ALP)

abx447699-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (APC)

abx447700-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (PerCP)

abx447705-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (RPE)

abx447706-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (Streptavidin)

abx447707-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 390)

abx447691-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 488)

abx447692-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 565)

abx447693-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 594)

abx447694-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 633)

abx447695-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 655)

abx447696-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 680)

abx447697-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 700)

abx447698-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

ATG10 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ATG10 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ATG10 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Antibody for Human ATG10

SPC-669D 0.1mg
EUR 354
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is unconjugated.

Antibody for Human ATG10

SPC-669D-A390 0.1mg
EUR 401
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 390.

Antibody for Human ATG10

SPC-669D-A488 0.1mg
EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 488.

Antibody for Human ATG10

SPC-669D-A565 0.1mg
EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 565.

Antibody for Human ATG10

SPC-669D-A594 0.1mg
EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 594.

Antibody for Human ATG10

SPC-669D-A633 0.1mg
EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 633.

Antibody for Human ATG10

SPC-669D-A655 0.1mg
EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 655.

Antibody for Human ATG10

SPC-669D-A680 0.1mg
EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 680.

Antibody for Human ATG10

SPC-669D-A700 0.1mg
EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 700.

Antibody for Human ATG10

SPC-669D-ALP 0.1mg
EUR 394
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human ATG10

SPC-669D-APC 0.1mg
EUR 399
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to APC .

Antibody for Human ATG10

SPC-669D-APCCY7 0.1mg
EUR 471
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to APC/Cy7.

Antibody for Human ATG10

SPC-669D-BI 0.1mg
EUR 396
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Biotin.

Antibody for Human ATG10

SPC-669D-DY350 0.1mg
EUR 414
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 350.

Antibody for Human ATG10

SPC-669D-DY405 0.1mg
EUR 403
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 405.

Antibody for Human ATG10

SPC-669D-DY488 0.1mg
EUR 393
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 488.

Antibody for Human ATG10

SPC-669D-DY594 0.1mg
EUR 395
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 594.

Antibody for Human ATG10

SPC-669D-DY633 0.1mg
EUR 390
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 633.

Antibody for Human ATG10

SPC-669D-FITC 0.1mg
EUR 392
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to FITC.

Antibody for Human ATG10

SPC-669D-HRP 0.1mg
EUR 388
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to HRP.

Antibody for Human ATG10

SPC-669D-P594 0.1mg
EUR 407
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to PE/ATTO 594.

Antibody for Human ATG10

SPC-669D-PCP 0.1mg
EUR 399
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to PerCP.

Antibody for Human ATG10

SPC-669D-RPE 0.1mg
EUR 397
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to RPE .

Antibody for Human ATG10

SPC-669D-STR 0.1mg
EUR 398
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Streptavidin.

Antibody for Human ATG10

SPC-669S 0.012mg
EUR 65
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is unconjugated.

Human Ubiquitin-like-conjugating enzyme ATG10 (ATG10)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 52.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ubiquitin-like-conjugating enzyme ATG10(ATG10) expressed in E.coli

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (PE/ATTO 594)

abx447704-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

ATG10 Blocking Peptide

33R-9235 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATG10 antibody, catalog no. 70R-3584

ATG10 Blocking Peptide

DF8366-BP 1mg
EUR 195

ATG10 cloning plasmid

CSB-CL861988HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 651
  • Sequence: atgagttcattggagaaaaaacattccaacgttattgtgcagaattcattaaacattcacaacataggtgatagttgggaatggagaccatcaaaggactgttctgatggctacatgtgcaaaatacactttcaaattaagaatgggtctgtgatgtcacatctaggagcatctac
  • Show more
Description: A cloning plasmid for the ATG10 gene.

ATG10 cloning plasmid

CSB-CL861988HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 663
  • Sequence: atggaagaagatgagttcattggagaaaaaacattccaacgttattgtgcagaattcattaaacattcacaacagataggtgatagttgggaatggagaccatcaaaggactgttctgatggctacatgtgcaaaatacactttcaaattaagaatgggtctgtgatgtcacatct
  • Show more
Description: A cloning plasmid for the ATG10 gene.

Human ATG10 Antibody (Biotin Conjugate)

32244-05121 150 ug
EUR 369

Autophagy Related 10 (ATG10) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Autophagy Related 10 (ATG10) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Apg10 (Atg10) recombinant monoclonal antibody

A5711 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human Apg10 (Atg10) for WB ,ELISA

Mouse Ubiquitin- like- conjugating enzyme ATG10, Atg10 ELISA KIT

ELI-24028m 96 Tests
EUR 865

Human Ubiquitin- like- conjugating enzyme ATG10, ATG10 ELISA KIT

ELI-34706h 96 Tests
EUR 824

Human ATG10 AssayLite Antibody (FITC Conjugate)

32244-05141 150 ug
EUR 428

Human ATG10 AssayLite Antibody (RPE Conjugate)

32244-05151 150 ug
EUR 428

Human ATG10 AssayLite Antibody (APC Conjugate)

32244-05161 150 ug
EUR 428

Human ATG10 AssayLite Antibody (PerCP Conjugate)

32244-05171 150 ug
EUR 471

Autophagy Related 10 (ATG10) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Autophagy Related 10 (ATG10) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Autophagy Related 10 (ATG10) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATG10 protein (His tag)

80R-2494 100 ug
EUR 322
Description: Purified recombinant ATG10 protein (His tag)

Mouse ATG10 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ATG10 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-Myc-ATG10 Plasmid

PVTB00420-2a 2 ug
EUR 356

pCMV-SPORT6-ATG10 Plasmid

PVT16512 2 ug
EUR 325

ATG10 Recombinant Protein (Human)

RP002188 100 ug Ask for price

ATG10 Recombinant Protein (Human)

RP002191 100 ug Ask for price

ATG10 Recombinant Protein (Mouse)

RP117734 100 ug Ask for price

ATG10 Recombinant Protein (Rat)

RP191300 100 ug Ask for price

Atg10 ORF Vector (Rat) (pORF)

ORF063768 1.0 ug DNA
EUR 506

ATG10 ORF Vector (Human) (pORF)

ORF000730 1.0 ug DNA
EUR 95

ATG10 ORF Vector (Human) (pORF)

ORF000731 1.0 ug DNA
EUR 95

Atg10 ORF Vector (Mouse) (pORF)

ORF039246 1.0 ug DNA
EUR 506

Atg10 sgRNA CRISPR Lentivector set (Mouse)

K4763001 3 x 1.0 ug
EUR 339

Atg10 sgRNA CRISPR Lentivector set (Rat)

K6746201 3 x 1.0 ug
EUR 339

ATG10 sgRNA CRISPR Lentivector set (Human)

K0142801 3 x 1.0 ug
EUR 339

ATG10-AS1 ORF Vector (Human) (pORF)

ORF015904 1.0 ug DNA Ask for price

ATG10-IT1 ORF Vector (Human) (pORF)

ORF015905 1.0 ug DNA Ask for price

Atg10 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4763002 1.0 ug DNA
EUR 154

Atg10 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4763003 1.0 ug DNA
EUR 154

Atg10 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4763004 1.0 ug DNA
EUR 154

Atg10 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6746202 1.0 ug DNA
EUR 154

Atg10 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6746203 1.0 ug DNA
EUR 154

Atg10 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6746204 1.0 ug DNA
EUR 154

ATG10 sgRNA CRISPR Lentivector (Human) (Target 1)

K0142802 1.0 ug DNA
EUR 154

ATG10 sgRNA CRISPR Lentivector (Human) (Target 2)

K0142803 1.0 ug DNA
EUR 154

ATG10 sgRNA CRISPR Lentivector (Human) (Target 3)

K0142804 1.0 ug DNA
EUR 154

ATG10 Autophagy Related 10 Human Recombinant Protein

PROTQ9H0Y0 Regular: 20ug
EUR 317
Description: ATG10 Human Recombinant produced in E. coli is a single polypeptide chain containing 243 amino acids (1-220) and having a molecular mass of 27.7 kDa.;ATG10 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

ATG10 Protein Vector (Mouse) (pPB-C-His)

PV156982 500 ng
EUR 603

ATG10 Protein Vector (Mouse) (pPB-N-His)

PV156983 500 ng
EUR 603

ATG10 Protein Vector (Mouse) (pPM-C-HA)

PV156984 500 ng
EUR 603

ATG10 Protein Vector (Mouse) (pPM-C-His)

PV156985 500 ng
EUR 603

ATG10 Protein Vector (Rat) (pPB-C-His)

PV255070 500 ng
EUR 603

ATG10 Protein Vector (Rat) (pPB-N-His)

PV255071 500 ng
EUR 603

ATG10 Protein Vector (Rat) (pPM-C-HA)

PV255072 500 ng
EUR 603

ATG10 Protein Vector (Rat) (pPM-C-His)

PV255073 500 ng
EUR 603

ATG10 Protein Vector (Human) (pPB-His-MBP)

PV324714 500 ng
EUR 329

ATG10 Protein Vector (Human) (pPB-His-GST)

PV324715 500 ng
EUR 329

ATG10 Protein Vector (Human) (pPB-His-MBP)

PV324718 500 ng
EUR 329

ATG10 Protein Vector (Human) (pPB-His-GST)

PV324719 500 ng
EUR 329

ATG10 Protein Vector (Human) (pPB-C-His)

PV002917 500 ng
EUR 329

ATG10 Protein Vector (Human) (pPB-N-His)

PV002918 500 ng
EUR 329

ATG10 Protein Vector (Human) (pPM-C-HA)

PV002919 500 ng
EUR 329

ATG10 Protein Vector (Human) (pPM-C-His)

PV002920 500 ng
EUR 329

ATG10 Protein Vector (Human) (pPB-C-His)

PV002921 500 ng
EUR 329

ATG10 Protein Vector (Human) (pPB-N-His)

PV002922 500 ng
EUR 329

ATG10 Protein Vector (Human) (pPM-C-HA)

PV002923 500 ng
EUR 329

ATG10 Protein Vector (Human) (pPM-C-His)

PV002924 500 ng
EUR 329

Atg10 3'UTR GFP Stable Cell Line

TU152261 1.0 ml Ask for price

Atg10 3'UTR Luciferase Stable Cell Line

TU102261 1.0 ml Ask for price

Atg10 3'UTR Luciferase Stable Cell Line

TU201021 1.0 ml Ask for price

Atg10 3'UTR GFP Stable Cell Line

TU251021 1.0 ml Ask for price

ATG10 3'UTR GFP Stable Cell Line

TU051346 1.0 ml
EUR 1521

ATG10 3'UTR Luciferase Stable Cell Line

TU001346 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)


ATG10 Rabbit Polyclonal Antibody