ATG10 Rabbit Polyclonal Antibody
ATG10 Polyclonal Antibody |
A67182 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
ATG10 Polyclonal Antibody |
ABP57837-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG10 from Human. This ATG10 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50 |
ATG10 Polyclonal Antibody |
ABP57837-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG10 from Human. This ATG10 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50 |
ATG10 Polyclonal Antibody |
ABP57837-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG10 from Human. This ATG10 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50 |
ATG10 Polyclonal Antibody |
ES8763-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG10 from Human. This antibody is tested and validated for IHC, WB, ELISA |
ATG10 Polyclonal Antibody |
ES8763-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG10 from Human. This antibody is tested and validated for IHC, WB, ELISA |
ATG10 Rabbit pAb |
A7390-100ul |
Abclonal |
100 ul |
EUR 308 |
ATG10 Rabbit pAb |
A7390-200ul |
Abclonal |
200 ul |
EUR 459 |
ATG10 Rabbit pAb |
A7390-20ul |
Abclonal |
20 ul |
EUR 183 |
ATG10 Rabbit pAb |
A7390-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal APG10/ATG10 Antibody |
APR00221G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human APG10/ATG10 . This antibody is tested and proven to work in the following applications: |
ATG10 Polyclonal Conjugated Antibody |
C46882 |
SAB |
100ul |
EUR 397 |
ATG10 Antibody |
24607-100ul |
SAB |
100ul |
EUR 390 |
ATG10 antibody |
70R-12183 |
Fitzgerald |
100 ug |
EUR 447 |
Description: Rabbit polyclonal ATG10 antibody |
ATG10 Antibody |
36115-100ul |
SAB |
100ul |
EUR 252 |
ATG10 Antibody |
1-CSB-PA828297 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200 |
ATG10 Antibody |
1-CSB-PA861988ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
ATG10 Antibody |
1-CSB-PA861988LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
ATG10 Antibody |
DF8366 |
Affbiotech |
200ul |
EUR 304 |
Description: ATG10 Antibody detects endogenous levels of total ATG10. |
ATG10 Antibody |
1-CSB-PA167980 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200 |
ATG10 antibody |
70R-3584 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ATG10 antibody |
Polyclonal ATG10 Antibody (N-term) |
APR07066G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG10 (N-term). This antibody is tested and proven to work in the following applications: |
ATG10 Polyclonal Antibody, HRP Conjugated |
A67183 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
ATG10 Polyclonal Antibody, FITC Conjugated |
A67184 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
ATG10 Polyclonal Antibody, Biotin Conjugated |
A67185 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Anti-Apg10 (Atg10) Rabbit Monoclonal Antibody |
M07803 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Apg10 (Atg10) Antibody. Validated in IP, WB and tested in Human. |
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody |
20-abx006473 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody |
20-abx320319 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody |
abx448529-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody |
20-abx310646 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody |
20-abx225049 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Human ATG10 Antibody |
32244-05111 |
AssayPro |
150 ug |
EUR 261 |
APG10/ATG10 Antibody |
3910-100 |
Biovision |
|
EUR 338 |
ATG10 Conjugated Antibody |
C36115 |
SAB |
100ul |
EUR 397 |
ATG10 Antibody (Biotin) |
abx447701-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
ATG10 Antibody (FITC) |
abx447702-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
ATG10 Antibody (HRP) |
abx447703-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Anti-ATG10 antibody |
STJ98826 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to ATG10. |
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ALP) |
abx447699-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (APC) |
abx447700-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (PerCP) |
abx447705-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (RPE) |
abx447706-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (Streptavidin) |
abx447707-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
ATG10 siRNA |
20-abx908442 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATG10 siRNA |
20-abx908443 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 390) |
abx447691-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 488) |
abx447692-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 565) |
abx447693-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 594) |
abx447694-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 633) |
abx447695-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 655) |
abx447696-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 680) |
abx447697-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 700) |
abx447698-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
ATG10 Antibody, HRP conjugated |
1-CSB-PA861988LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ATG10 Antibody, FITC conjugated |
1-CSB-PA861988LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ATG10 Antibody, Biotin conjugated |
1-CSB-PA861988LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Antibody for Human ATG10 |
SPC-669D |
Stressmarq |
0.1mg |
EUR 354 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is unconjugated. |
Antibody for Human ATG10 |
SPC-669D-A390 |
Stressmarq |
0.1mg |
EUR 401 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 390. |
Antibody for Human ATG10 |
SPC-669D-A488 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 488. |
Antibody for Human ATG10 |
SPC-669D-A565 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 565. |
Antibody for Human ATG10 |
SPC-669D-A594 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 594. |
Antibody for Human ATG10 |
SPC-669D-A633 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 633. |
Antibody for Human ATG10 |
SPC-669D-A655 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 655. |
Antibody for Human ATG10 |
SPC-669D-A680 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 680. |
Antibody for Human ATG10 |
SPC-669D-A700 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 700. |
Antibody for Human ATG10 |
SPC-669D-ALP |
Stressmarq |
0.1mg |
EUR 394 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human ATG10 |
SPC-669D-APC |
Stressmarq |
0.1mg |
EUR 399 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to APC . |
Antibody for Human ATG10 |
SPC-669D-APCCY7 |
Stressmarq |
0.1mg |
EUR 471 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to APC/Cy7. |
Antibody for Human ATG10 |
SPC-669D-BI |
Stressmarq |
0.1mg |
EUR 396 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Biotin. |
Antibody for Human ATG10 |
SPC-669D-DY350 |
Stressmarq |
0.1mg |
EUR 414 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 350. |
Antibody for Human ATG10 |
SPC-669D-DY405 |
Stressmarq |
0.1mg |
EUR 403 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 405. |
Antibody for Human ATG10 |
SPC-669D-DY488 |
Stressmarq |
0.1mg |
EUR 393 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 488. |
Antibody for Human ATG10 |
SPC-669D-DY594 |
Stressmarq |
0.1mg |
EUR 395 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 594. |
Antibody for Human ATG10 |
SPC-669D-DY633 |
Stressmarq |
0.1mg |
EUR 390 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 633. |
Antibody for Human ATG10 |
SPC-669D-FITC |
Stressmarq |
0.1mg |
EUR 392 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to FITC. |
Antibody for Human ATG10 |
SPC-669D-HRP |
Stressmarq |
0.1mg |
EUR 388 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to HRP. |
Antibody for Human ATG10 |
SPC-669D-P594 |
Stressmarq |
0.1mg |
EUR 407 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to PE/ATTO 594. |
Antibody for Human ATG10 |
SPC-669D-PCP |
Stressmarq |
0.1mg |
EUR 399 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to PerCP. |
Antibody for Human ATG10 |
SPC-669D-RPE |
Stressmarq |
0.1mg |
EUR 397 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to RPE . |
Antibody for Human ATG10 |
SPC-669D-STR |
Stressmarq |
0.1mg |
EUR 398 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Streptavidin. |
Antibody for Human ATG10 |
SPC-669S |
Stressmarq |
0.012mg |
EUR 65 |
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is unconjugated. |
Human Ubiquitin-like-conjugating enzyme ATG10 (ATG10) |
1-CSB-EP861988HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 52.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Ubiquitin-like-conjugating enzyme ATG10(ATG10) expressed in E.coli |
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (PE/ATTO 594) |
abx447704-100ug |
Abbexa |
100 ug |
EUR 592 |
- Shipped within 5-12 working days.
|
ATG10 Blocking Peptide |
33R-9235 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATG10 antibody, catalog no. 70R-3584 |
ATG10 Blocking Peptide |
DF8366-BP |
Affbiotech |
1mg |
EUR 195 |
ATG10 cloning plasmid |
CSB-CL861988HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 651
- Sequence: atgagttcattggagaaaaaacattccaacgttattgtgcagaattcattaaacattcacaacataggtgatagttgggaatggagaccatcaaaggactgttctgatggctacatgtgcaaaatacactttcaaattaagaatgggtctgtgatgtcacatctaggagcatctac
- Show more
|
Description: A cloning plasmid for the ATG10 gene. |
ATG10 cloning plasmid |
CSB-CL861988HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 663
- Sequence: atggaagaagatgagttcattggagaaaaaacattccaacgttattgtgcagaattcattaaacattcacaacagataggtgatagttgggaatggagaccatcaaaggactgttctgatggctacatgtgcaaaatacactttcaaattaagaatgggtctgtgatgtcacatct
- Show more
|
Description: A cloning plasmid for the ATG10 gene. |
Human ATG10 Antibody (Biotin Conjugate) |
32244-05121 |
AssayPro |
150 ug |
EUR 369 |
Autophagy Related 10 (ATG10) Antibody |
20-abx211898 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Autophagy Related 10 (ATG10) Antibody |
20-abx211899 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Apg10 (Atg10) recombinant monoclonal antibody |
A5711 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human Apg10 (Atg10) for WB ,ELISA |
Mouse Ubiquitin- like- conjugating enzyme ATG10, Atg10 ELISA KIT |
ELI-24028m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Ubiquitin- like- conjugating enzyme ATG10, ATG10 ELISA KIT |
ELI-34706h |
Lifescience Market |
96 Tests |
EUR 824 |
Human ATG10 AssayLite Antibody (FITC Conjugate) |
32244-05141 |
AssayPro |
150 ug |
EUR 428 |
Human ATG10 AssayLite Antibody (RPE Conjugate) |
32244-05151 |
AssayPro |
150 ug |
EUR 428 |
Human ATG10 AssayLite Antibody (APC Conjugate) |
32244-05161 |
AssayPro |
150 ug |
EUR 428 |
Human ATG10 AssayLite Antibody (PerCP Conjugate) |
32244-05171 |
AssayPro |
150 ug |
EUR 471 |
Autophagy Related 10 (ATG10) Antibody (HRP) |
20-abx310647 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Autophagy Related 10 (ATG10) Antibody (FITC) |
20-abx310648 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Autophagy Related 10 (ATG10) Antibody (Biotin) |
20-abx310649 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATG10 protein (His tag) |
80R-2494 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Purified recombinant ATG10 protein (His tag) |
Mouse ATG10 shRNA Plasmid |
20-abx975785 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ATG10 shRNA Plasmid |
20-abx963181 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ATG10 Recombinant Protein (Human) |
RP002188 |
ABM |
100 ug |
Ask for price |
ATG10 Recombinant Protein (Human) |
RP002191 |
ABM |
100 ug |
Ask for price |
ATG10 Recombinant Protein (Mouse) |
RP117734 |
ABM |
100 ug |
Ask for price |
ATG10 Recombinant Protein (Rat) |
RP191300 |
ABM |
100 ug |
Ask for price |
Atg10 ORF Vector (Rat) (pORF) |
ORF063768 |
ABM |
1.0 ug DNA |
EUR 506 |
ATG10 ORF Vector (Human) (pORF) |
ORF000730 |
ABM |
1.0 ug DNA |
EUR 95 |
ATG10 ORF Vector (Human) (pORF) |
ORF000731 |
ABM |
1.0 ug DNA |
EUR 95 |
Atg10 ORF Vector (Mouse) (pORF) |
ORF039246 |
ABM |
1.0 ug DNA |
EUR 506 |
Atg10 sgRNA CRISPR Lentivector set (Mouse) |
K4763001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Atg10 sgRNA CRISPR Lentivector set (Rat) |
K6746201 |
ABM |
3 x 1.0 ug |
EUR 339 |
ATG10 sgRNA CRISPR Lentivector set (Human) |
K0142801 |
ABM |
3 x 1.0 ug |
EUR 339 |
ATG10-AS1 ORF Vector (Human) (pORF) |
ORF015904 |
ABM |
1.0 ug DNA |
Ask for price |
ATG10-IT1 ORF Vector (Human) (pORF) |
ORF015905 |
ABM |
1.0 ug DNA |
Ask for price |
Atg10 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4763002 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg10 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4763003 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg10 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4763004 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg10 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6746202 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg10 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6746203 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg10 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6746204 |
ABM |
1.0 ug DNA |
EUR 154 |
ATG10 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0142802 |
ABM |
1.0 ug DNA |
EUR 154 |
ATG10 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0142803 |
ABM |
1.0 ug DNA |
EUR 154 |
ATG10 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0142804 |
ABM |
1.0 ug DNA |
EUR 154 |
ATG10 Autophagy Related 10 Human Recombinant Protein |
PROTQ9H0Y0 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: ATG10 Human Recombinant produced in E. coli is a single polypeptide chain containing 243 amino acids (1-220) and having a molecular mass of 27.7 kDa.;ATG10 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
ATG10 Protein Vector (Mouse) (pPB-C-His) |
PV156982 |
ABM |
500 ng |
EUR 603 |
ATG10 Protein Vector (Mouse) (pPB-N-His) |
PV156983 |
ABM |
500 ng |
EUR 603 |
ATG10 Protein Vector (Mouse) (pPM-C-HA) |
PV156984 |
ABM |
500 ng |
EUR 603 |
ATG10 Protein Vector (Mouse) (pPM-C-His) |
PV156985 |
ABM |
500 ng |
EUR 603 |
ATG10 Protein Vector (Rat) (pPB-C-His) |
PV255070 |
ABM |
500 ng |
EUR 603 |
ATG10 Protein Vector (Rat) (pPB-N-His) |
PV255071 |
ABM |
500 ng |
EUR 603 |
ATG10 Protein Vector (Rat) (pPM-C-HA) |
PV255072 |
ABM |
500 ng |
EUR 603 |
ATG10 Protein Vector (Rat) (pPM-C-His) |
PV255073 |
ABM |
500 ng |
EUR 603 |
ATG10 Protein Vector (Human) (pPB-His-MBP) |
PV324714 |
ABM |
500 ng |
EUR 329 |
ATG10 Protein Vector (Human) (pPB-His-GST) |
PV324715 |
ABM |
500 ng |
EUR 329 |
ATG10 Protein Vector (Human) (pPB-His-MBP) |
PV324718 |
ABM |
500 ng |
EUR 329 |
ATG10 Protein Vector (Human) (pPB-His-GST) |
PV324719 |
ABM |
500 ng |
EUR 329 |
ATG10 Protein Vector (Human) (pPB-C-His) |
PV002917 |
ABM |
500 ng |
EUR 329 |
ATG10 Protein Vector (Human) (pPB-N-His) |
PV002918 |
ABM |
500 ng |
EUR 329 |
ATG10 Protein Vector (Human) (pPM-C-HA) |
PV002919 |
ABM |
500 ng |
EUR 329 |
ATG10 Protein Vector (Human) (pPM-C-His) |
PV002920 |
ABM |
500 ng |
EUR 329 |
ATG10 Protein Vector (Human) (pPB-C-His) |
PV002921 |
ABM |
500 ng |
EUR 329 |
ATG10 Protein Vector (Human) (pPB-N-His) |
PV002922 |
ABM |
500 ng |
EUR 329 |
ATG10 Protein Vector (Human) (pPM-C-HA) |
PV002923 |
ABM |
500 ng |
EUR 329 |
ATG10 Protein Vector (Human) (pPM-C-His) |
PV002924 |
ABM |
500 ng |
EUR 329 |
Atg10 3'UTR GFP Stable Cell Line |
TU152261 |
ABM |
1.0 ml |
Ask for price |
Atg10 3'UTR Luciferase Stable Cell Line |
TU102261 |
ABM |
1.0 ml |
Ask for price |
Atg10 3'UTR Luciferase Stable Cell Line |
TU201021 |
ABM |
1.0 ml |
Ask for price |
Atg10 3'UTR GFP Stable Cell Line |
TU251021 |
ABM |
1.0 ml |
Ask for price |
ATG10 3'UTR GFP Stable Cell Line |
TU051346 |
ABM |
1.0 ml |
EUR 1521 |
ATG10 3'UTR Luciferase Stable Cell Line |
TU001346 |
ABM |
1.0 ml |
EUR 1521 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
ATG10 Rabbit Polyclonal Antibody