AP2M1 Rabbit Polyclonal Antibody

AP2M1 Rabbit Polyclonal Antibody


AP2M1 Polyclonal Antibody

ABP57785-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of AP2M1 from Human, Mouse, Rat. This AP2M1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180

AP2M1 Polyclonal Antibody

ABP57785-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of AP2M1 from Human, Mouse, Rat. This AP2M1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180

AP2M1 Polyclonal Antibody

A53865 100 µg
EUR 570.55
Description: Ask the seller for details

AP2M1 Polyclonal Antibody

A54500 100 µg
EUR 570.55
Description: The best epigenetics products

AP2M1 Rabbit mAb

A11070-100ul 100 ul
EUR 410

AP2M1 Rabbit mAb

A11070-200ul 200 ul
EUR 571

AP2M1 Rabbit mAb

A11070-20ul 20 ul
EUR 221

AP2M1 Rabbit mAb

A11070-50ul 50 ul
EUR 287

AP2M1 Rabbit pAb

A13962-100ul 100 ul
EUR 308

AP2M1 Rabbit pAb

A13962-200ul 200 ul
EUR 459

AP2M1 Rabbit pAb

A13962-20ul 20 ul
EUR 183

AP2M1 Rabbit pAb

A13962-50ul 50 ul
EUR 223

AP2M1 Rabbit pAb

A2492-100ul 100 ul
EUR 308

AP2M1 Rabbit pAb

A2492-200ul 200 ul
EUR 459

AP2M1 Rabbit pAb

A2492-20ul 20 ul
EUR 183

AP2M1 Rabbit pAb

A2492-50ul 50 ul
EUR 223

AP2M1 Polyclonal Antibody, HRP Conjugated

A53866 100 µg
EUR 570.55
Description: The best epigenetics products

AP2M1 Polyclonal Antibody, FITC Conjugated

A53867 100 µg
EUR 570.55
Description: kits suitable for this type of research

AP2M1 Polyclonal Antibody, Biotin Conjugated

A53868 100 µg
EUR 570.55
Description: fast delivery possible

AP2M1 Polyclonal Antibody, HRP Conjugated

A54501 100 µg
EUR 570.55
Description: kits suitable for this type of research

AP2M1 Polyclonal Antibody, FITC Conjugated

A54502 100 µg
EUR 570.55
Description: fast delivery possible

AP2M1 Polyclonal Antibody, Biotin Conjugated

A54503 100 µg
EUR 570.55
Description: reagents widely cited

Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit

DLR-AP2m1-Hu-48T 48T
EUR 517
  • Should the Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) in samples from tissue homogenates or other biological fluids.

Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit

DLR-AP2m1-Hu-96T 96T
EUR 673
  • Should the Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) in samples from tissue homogenates or other biological fluids.

Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit

RD-AP2m1-Hu-48Tests 48 Tests
EUR 521

Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit

RD-AP2m1-Hu-96Tests 96 Tests
EUR 723

Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit

RDR-AP2m1-Hu-48Tests 48 Tests
EUR 544

Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit

RDR-AP2m1-Hu-96Tests 96 Tests
EUR 756

AP2M1 antibody

70R-49558 100 ul
EUR 244
Description: Purified Polyclonal AP2M1 antibody

AP2M1 antibody

70R-36178 100 ug
EUR 349
Description: Rabbit polyclonal AP2M1 antibody

AP2M1 Antibody

ABD6961 100 ug
EUR 438

AP2M1 Antibody

49143-100ul 100ul
EUR 333

AP2M1 Antibody

49143-50ul 50ul
EUR 239

AP2M1 Antibody

32670-100ul 100ul
EUR 252

AP2M1 antibody

10R-3324 100 ul
EUR 691
Description: Mouse monoclonal AP2M1 antibody

AP2M1 antibody

10R-3326 100 ul
EUR 691
Description: Mouse monoclonal AP2M1 antibody

AP2M1 antibody

10R-3327 100 ul
EUR 691
Description: Mouse monoclonal AP2M1 antibody

AP2M1 antibody

10R-3331 100 ul
EUR 691
Description: Mouse monoclonal AP2M1 antibody

AP2M1 Antibody

24892-100ul 100ul
EUR 390

AP2M1 antibody

70R-12583 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal AP2M1 antibody

AP2M1 antibody

70R-15215 100 ug
EUR 327
Description: Rabbit polyclonal AP2M1 antibody

AP2M1 Antibody

DF6961 200ul
EUR 304
Description: AP2M1 Antibody detects endogenous levels of total AP2M1.

AP2M1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

AP2M1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

AP2M1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

AP2M1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

AP2M1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

Phospho-AP2M1-T156 Rabbit pAb

AP0823-100ul 100 ul
EUR 384

Phospho-AP2M1-T156 Rabbit pAb

AP0823-200ul 200 ul
EUR 554

Phospho-AP2M1-T156 Rabbit pAb

AP0823-20ul 20 ul
EUR 183

Phospho-AP2M1-T156 Rabbit pAb

AP0823-50ul 50 ul
EUR 265

AP2M1 Conjugated Antibody

C49143 100ul
EUR 397

AP2M1 Conjugated Antibody

C32670 100ul
EUR 397

Anti-AP2M1 Antibody

A06179 100ug/vial
EUR 294

AP2M1 antibody (HRP)

60R-1485 100 ug
EUR 327
Description: Rabbit polyclonal AP2M1 antibody (HRP)

AP2M1 antibody (FITC)

60R-1486 100 ug
EUR 327
Description: Rabbit polyclonal AP2M1 antibody (FITC)

AP2M1 antibody (biotin)

60R-1487 100 ug
EUR 327
Description: Rabbit polyclonal AP2M1 antibody (biotin)

Anti-AP2M1 antibody

STJ22628 100 µl
EUR 277
Description: This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene.

Anti-AP2M1 antibody

STJ190156 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AP2M1

Anti-AP2M1 antibody

STJ115897 100 µl
EUR 277
Description: This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene.

Rabbit Anti-AP2M1 monoclonal antibody, clone TE0857

DCABH-9663 100 ul
EUR 777

Ap2m1/ Rat Ap2m1 ELISA Kit

ELI-24339r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AP2M1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AP2M1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AP2M1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

AP2M1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AP2M1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AP2M1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-AP2M1/Ap 2 Mu 1 Rabbit Monoclonal Antibody

M06179 100ug/vial
EUR 397
Description: Rabbit Monoclonal AP2M1/Ap 2 Mu 1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

AP2M1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

AP2M1 Blocking Peptide

DF6961-BP 1mg
EUR 195

AP2M1 cloning plasmid

CSB-CL850274HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1308
  • Sequence: atgattggaggcttattcatctataatcacaagggggaggtgctcatctcccgagtctaccgagatgacatcgggaggaacgcagtggatgcctttcgggtcaatgttatccatgcccggcagcaggtgcgcagccccgtcaccaacattgctcgcaccagcttcttccacgtta
  • Show more
Description: A cloning plasmid for the AP2M1 gene.

AP2M1 cloning plasmid

CSB-CL850274HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: atgattggaggcttattcatctataatcacaagggggaggtgctcatctcccgagtctaccgagatgacatcgggaggaacgcagtggatgcctttcgggtcaatgttatccatgcccggcagcaggtgcgcagccccgtcaccaacattgctcgcaccagcttcttccacgtta
  • Show more
Description: A cloning plasmid for the AP2M1 gene.

pDONR223-AP2M1 Plasmid

PVTB01145-1 2 ug
EUR 356

pENTR223-AP2M1 vector

PVT12121 2 ug
EUR 308

Anti-Phospho-AP2M1-(T156) antibody

STJ117921 100 µl
EUR 393
Description: This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene.

Rat AP2M1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


AP2M1 Rabbit Polyclonal Antibody