AGK Rabbit Polyclonal Antibody
AGK Polyclonal Antibody |
ABP57726-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human AGK protein at amino acid sequence of 330-410
- Applications tips:
|
Description: A polyclonal antibody for detection of AGK from Human, Mouse. This AGK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AGK protein at amino acid sequence of 330-410 |
AGK Polyclonal Antibody |
ES9068-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against AGK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
AGK Polyclonal Antibody |
ES9068-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against AGK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Acylglycerol Kinase (AGK) ELISA Kit |
DLR-AGK-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Acylglycerol Kinase (AGK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Acylglycerol Kinase (AGK) in samples from tissue homogenates or other biological fluids. |
Human Acylglycerol Kinase (AGK) ELISA Kit |
DLR-AGK-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Acylglycerol Kinase (AGK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Acylglycerol Kinase (AGK) in samples from tissue homogenates or other biological fluids. |
Human Acylglycerol Kinase (AGK) ELISA Kit |
RD-AGK-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Acylglycerol Kinase (AGK) ELISA Kit |
RD-AGK-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Acylglycerol Kinase (AGK) ELISA Kit |
RDR-AGK-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Acylglycerol Kinase (AGK) ELISA Kit |
RDR-AGK-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
AGK Rabbit pAb |
A9976-100ul |
Abclonal |
100 ul |
EUR 308 |
AGK Rabbit pAb |
A9976-200ul |
Abclonal |
200 ul |
EUR 459 |
AGK Rabbit pAb |
A9976-20ul |
Abclonal |
20 ul |
EUR 183 |
AGK Rabbit pAb |
A9976-50ul |
Abclonal |
50 ul |
EUR 223 |
AGK Antibody |
45528-100ul |
SAB |
100ul |
EUR 252 |
AGK Antibody |
45528-50ul |
SAB |
50ul |
EUR 187 |
AGK Antibody |
1-CSB-PA706634LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AGK. Recognizes AGK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
AGK Antibody |
DF8835 |
Affbiotech |
200ul |
EUR 304 |
Description: AGK Antibody detects endogenous levels of total AGK. |
AGK antibody |
70R-3532 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal AGK antibody raised against the N terminal of AGK |
AGK antibody |
70R-9479 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal AGK antibody |
AGK Monoclonal Antibody |
29784-100ul |
SAB |
100ul |
EUR 252 |
AGK Monoclonal Antibody |
29784-50ul |
SAB |
50ul |
EUR 187 |
AGK Conjugated Antibody |
C45528 |
SAB |
100ul |
EUR 397 |
Anti-AGK antibody |
STJ112017 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a mitochondrial membrane protein involved in lipid and glycerolipid metabolism. The encoded protein is a lipid kinase that catalyzes the formation of phosphatidic and lysophosphatidic acids. Defects in this gene have been associated with mitochondrial DNA depletion syndrome 10. |
Anti-AGK antibody |
STJ190226 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to AGK |
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse) |
4-PAG236Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AGK (Thr15~Pro300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK) |
AGK 2 |
B7323-10 |
ApexBio |
10 mg |
EUR 273 |
Description: AGK 2 is a potent and selective inhibitor of sirtuin 2 with IC50 value of 3.5 ?M [1]. Sirtuin 2 (SIRT2) is a NAD-dependent deacetylase and is involved in cell cycle regulation through ?-tubulin deacetylation. |
AGK 2 |
B7323-5.1 |
ApexBio |
10 mM (in 1mL DMSO) |
EUR 247 |
Description: AGK 2 is a potent and selective inhibitor of sirtuin 2 with IC50 value of 3.5 ?M [1]. Sirtuin 2 (SIRT2) is a NAD-dependent deacetylase and is involved in cell cycle regulation through ?-tubulin deacetylation. |
AGK 2 |
B7323-50 |
ApexBio |
50 mg |
EUR 986 |
Description: AGK 2 is a potent and selective inhibitor of sirtuin 2 with IC50 value of 3.5 ?M [1]. Sirtuin 2 (SIRT2) is a NAD-dependent deacetylase and is involved in cell cycle regulation through ?-tubulin deacetylation. |
AGK siRNA |
20-abx906999 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AGK siRNA |
20-abx907000 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AGK Antibody, HRP conjugated |
1-CSB-PA706634LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AGK. Recognizes AGK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
AGK Antibody, FITC conjugated |
1-CSB-PA706634LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AGK. Recognizes AGK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
AGK Antibody, Biotin conjugated |
1-CSB-PA706634LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AGK. Recognizes AGK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Acylglycerol Kinase (AGK) Antibody |
abx036608-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Acylglycerol Kinase (AGK) Antibody |
20-abx131353 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Acylglycerol Kinase (AGK) Antibody |
20-abx135896 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Acylglycerol Kinase (AGK) Antibody |
20-abx148048 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Acylglycerol Kinase (AGK) Antibody |
20-abx171072 |
Abbexa |
|
|
|
AGK Monoclonal Conjugated Antibody |
C29784 |
SAB |
100ul |
EUR 397 |
Acylglycerol Kinase (AGK) Antibody |
abx432131-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), APC |
4-PAG236Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AGK (Thr15~Pro300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with APC. |
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAG236Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AGK (Thr15~Pro300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with Biotin. |
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAG236Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AGK (Thr15~Pro300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with Cy3. |
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), FITC |
4-PAG236Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AGK (Thr15~Pro300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with FITC. |
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), HRP |
4-PAG236Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AGK (Thr15~Pro300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with HRP. |
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), PE |
4-PAG236Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AGK (Thr15~Pro300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with PE. |
Rabbit Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E04A1324-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E04A1324-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E04A1324-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
AGK Mouse mAb |
A16230-100ul |
Abclonal |
100 ul |
EUR 384 |
AGK Mouse mAb |
A16230-200ul |
Abclonal |
200 ul |
EUR 554 |
AGK Mouse mAb |
A16230-20ul |
Abclonal |
20 ul |
EUR 183 |
AGK Mouse mAb |
A16230-50ul |
Abclonal |
50 ul |
EUR 265 |
AGK Blocking Peptide |
33R-2085 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AGK antibody, catalog no. 70R-9479 |
AGK Blocking Peptide |
33R-4482 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AGK antibody, catalog no. 70R-3532 |
AGK Blocking Peptide |
DF8835-BP |
Affbiotech |
1mg |
EUR 195 |
AGK cloning plasmid |
CSB-CL706634HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 198
- Sequence: atgacggtgttctttaaaacgcttcgaaatcactggaagaaaactacagctgggctctgcctgctgacctggggaggccattggctctatggaaaacactgtgataacctcctaaggagagcagcctgtcaagaagctcagcactatcaggatgaatcacgctgggagccaactct
- Show more
|
Description: A cloning plasmid for the AGK gene. |
AGK cloning plasmid |
CSB-CL706634HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1269
- Sequence: atgacggtgttctttaaaacgcttcgaaatcactggaagaaaactacagctgggctctgcctgctgacctggggaggccattggctctatggaaaacactgtgataacctcctaaggagagcagcctgtcaagaagctcaggtgtttggcaatcaactcattcctcccaatgcac
- Show more
|
Description: A cloning plasmid for the AGK gene. |
Acylglycerol Kinase, Mitochondrial (AGK) Antibody |
20-abx317853 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAG236Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AGK (Thr15~Pro300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with APC-Cy7. |
Acylglycerol Kinase, Mitochondrial (AGK) Antibody (HRP) |
20-abx314524 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Acylglycerol Kinase, Mitochondrial (AGK) Antibody (FITC) |
20-abx314525 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Acylglycerol Kinase, Mitochondrial (AGK) Antibody (Biotin) |
20-abx314526 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse AGK shRNA Plasmid |
20-abx977092 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human AGK shRNA Plasmid |
20-abx960887 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Recombinant Acylglycerol Kinase (AGK) |
4-RPG236Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q53H12
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 61.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Acylglycerol Kinase expressed in: E.coli |
AGK Recombinant Protein (Human) |
RP000730 |
ABM |
100 ug |
Ask for price |
AGK Recombinant Protein (Human) |
RP000733 |
ABM |
100 ug |
Ask for price |
AGK Recombinant Protein (Mouse) |
RP114779 |
ABM |
100 ug |
Ask for price |
AGK Recombinant Protein (Rat) |
RP189512 |
ABM |
100 ug |
Ask for price |
Human Acylglycerol Kinase (AGK) Protein |
20-abx650682 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Agk ORF Vector (Rat) (pORF) |
ORF063172 |
ABM |
1.0 ug DNA |
EUR 506 |
AGK ORF Vector (Human) (pORF) |
ORF000244 |
ABM |
1.0 ug DNA |
EUR 95 |
AGK ORF Vector (Human) (pORF) |
ORF000245 |
ABM |
1.0 ug DNA |
EUR 95 |
Agk ORF Vector (Mouse) (pORF) |
ORF038261 |
ABM |
1.0 ug DNA |
EUR 506 |
AGK ELISA Kit (Human) (OKCD00496) |
OKCD00496 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Lipid kinase that can phosphorylate both monoacylglycerol and diacylglycerol to form lysophosphatidic acid (LPA) and phosphatidic acid (PA), respectively. Does not phosphorylate sphingosine. Overexpression increases the formation and secretion of LPA, resulting in transactivation of EGFR and activation of the downstream MAPK signaling pathway, leading to increased cell growth.1 Publication
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.6"A novel acylglycerol kinase that produces lysophosphatidic acid modulates cross talk with EGFR in prostate cancer cells."_x005F_x005F_x000D_Bektas M., Payne S.G., Liu H., Goparaju S., Milstien S., Spiegel S._x005F_x005F_x000D_J. Cell Biol. 169:801-811(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, COFACTOR, SUBCELLULAR LOCATION, TISSUE SPECIFICITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.081 ng/mL |
AGK ELISA Kit (Human) (OKDD00117) |
OKDD00117 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: The protein encoded by this gene is a mitochondrial membrane protein involved in lipid and glycerolipid metabolism. The encoded protein is a lipid kinase that catalyzes the formation of phosphatidic and lysophosphatidic acids. Defects in this gene have been associated with mitochondrial DNA depletion syndrome 10.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.081 ng/mL |
Human Acylglycerol Kinase (AGK) ELISA Kit |
20-abx150540 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Acylglycerol Kinase (AGK) CLIA Kit |
20-abx495134 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Agk sgRNA CRISPR Lentivector set (Rat) |
K6147601 |
ABM |
3 x 1.0 ug |
EUR 339 |
AGK sgRNA CRISPR Lentivector set (Human) |
K0058001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Agk sgRNA CRISPR Lentivector set (Mouse) |
K4699601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Acylglycerol Kinase (AGK) ELISA Kit |
SEG236Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids. |
Human Acylglycerol Kinase (AGK) ELISA Kit |
SEG236Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids. |
Human Acylglycerol Kinase (AGK) ELISA Kit |
SEG236Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids. |
Human Acylglycerol Kinase (AGK) ELISA Kit |
SEG236Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids. |
Human Acylglycerol Kinase (AGK) ELISA Kit |
4-SEG236Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Acylglycerol Kinase elisa. Alternative names of the recognized antigen: MULK
- Multiple Substrate Lipid Kinase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Acylglycerol Kinase (AGK) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E01A1324-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E01A1324-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E01A1324-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E02A1324-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E02A1324-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E02A1324-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E06A1324-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E06A1324-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E06A1324-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E03A1324-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E03A1324-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E03A1324-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E07A1324-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E07A1324-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E07A1324-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E08A1324-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E08A1324-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E08A1324-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E09A1324-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E09A1324-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Acylglycerol kinase, mitochondrial(AGK) ELISA kit |
E09A1324-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Acylglycerol kinase, mitochondrial, Agk ELISA KIT |
ELI-11913m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Acylglycerol kinase, mitochondrial, AGK ELISA KIT |
ELI-24573h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human AGK (Acylglycerol Kinase) |
ELK3404 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Acylglycerol Kinase (AGK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Acylglyc
- Show more
|
Description: A sandwich ELISA kit for detection of Acylglycerol Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Agk sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6147602 |
ABM |
1.0 ug DNA |
EUR 154 |
Agk sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6147603 |
ABM |
1.0 ug DNA |
EUR 154 |
Agk sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6147604 |
ABM |
1.0 ug DNA |
EUR 154 |
AGK sgRNA CRISPR Lentivector (Human) (Target 1) |
K0058002 |
ABM |
1.0 ug DNA |
EUR 154 |
AGK sgRNA CRISPR Lentivector (Human) (Target 2) |
K0058003 |
ABM |
1.0 ug DNA |
EUR 154 |
AGK sgRNA CRISPR Lentivector (Human) (Target 3) |
K0058004 |
ABM |
1.0 ug DNA |
EUR 154 |
Agk sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4699602 |
ABM |
1.0 ug DNA |
EUR 154 |
Agk sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4699603 |
ABM |
1.0 ug DNA |
EUR 154 |
Agk sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4699604 |
ABM |
1.0 ug DNA |
EUR 154 |
AGK Protein Vector (Mouse) (pPB-C-His) |
PV153042 |
ABM |
500 ng |
EUR 603 |
AGK Protein Vector (Mouse) (pPB-N-His) |
PV153043 |
ABM |
500 ng |
EUR 603 |
AGK Protein Vector (Mouse) (pPM-C-HA) |
PV153044 |
ABM |
500 ng |
EUR 603 |
AGK Protein Vector (Mouse) (pPM-C-His) |
PV153045 |
ABM |
500 ng |
EUR 603 |
AGK Protein Vector (Rat) (pPB-C-His) |
PV252686 |
ABM |
500 ng |
EUR 603 |
AGK Protein Vector (Rat) (pPB-N-His) |
PV252687 |
ABM |
500 ng |
EUR 603 |
AGK Protein Vector (Rat) (pPM-C-HA) |
PV252688 |
ABM |
500 ng |
EUR 603 |
AGK Protein Vector (Rat) (pPM-C-His) |
PV252689 |
ABM |
500 ng |
EUR 603 |
AGK Protein Vector (Human) (pPB-His-MBP) |
PV320494 |
ABM |
500 ng |
EUR 329 |
AGK Protein Vector (Human) (pPB-His-GST) |
PV320495 |
ABM |
500 ng |
EUR 329 |
AGK Protein Vector (Human) (pPB-His-MBP) |
PV320498 |
ABM |
500 ng |
EUR 329 |
AGK Protein Vector (Human) (pPB-His-GST) |
PV320499 |
ABM |
500 ng |
EUR 329 |
AGK Protein Vector (Human) (pPB-C-His) |
PV000973 |
ABM |
500 ng |
EUR 329 |
AGK Protein Vector (Human) (pPB-N-His) |
PV000974 |
ABM |
500 ng |
EUR 329 |
AGK Protein Vector (Human) (pPM-C-HA) |
PV000975 |
ABM |
500 ng |
EUR 329 |
AGK Protein Vector (Human) (pPM-C-His) |
PV000976 |
ABM |
500 ng |
EUR 329 |
AGK Protein Vector (Human) (pPB-C-His) |
PV000977 |
ABM |
500 ng |
EUR 329 |
AGK Protein Vector (Human) (pPB-N-His) |
PV000978 |
ABM |
500 ng |
EUR 329 |
AGK Protein Vector (Human) (pPM-C-HA) |
PV000979 |
ABM |
500 ng |
EUR 329 |
AGK Protein Vector (Human) (pPM-C-His) |
PV000980 |
ABM |
500 ng |
EUR 329 |
Agk 3'UTR Luciferase Stable Cell Line |
TU101513 |
ABM |
1.0 ml |
Ask for price |
Agk 3'UTR GFP Stable Cell Line |
TU151513 |
ABM |
1.0 ml |
Ask for price |
Agk 3'UTR Luciferase Stable Cell Line |
TU200387 |
ABM |
1.0 ml |
Ask for price |
Agk 3'UTR GFP Stable Cell Line |
TU250387 |
ABM |
1.0 ml |
Ask for price |
AGK Rabbit Polyclonal Antibody